Rh2AG218100
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
22307036 .. 22340594
33559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG218100.1

Sequence Viewer

Length: 270 bp
ATGACAGTAACTGGGATCTTGCCGATGAACAGCTTAGGAGAACTTGAAGATTCATTCAAAGAGCACATAATCATTACAATACTCGGTGTTGTGCGAGATATTGAAAAGCTAGACCATGATTTTGCTCAGGAAAATTGTTATAACCCAGAAGTTATTAGCACTACAAAATTCAGGGATGCAGTTGCAAATGACGTCTTAATGTTCAATGTTATCATGAGTTATCCATTACAGTTACTCATTGGCAGGAGATCTCAATTGCAGCAAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.17

Weight (kDa)

4.74

Isoelectric Point (pI)

54.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 141
AatII GACGTC 1 cut(s) 195
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 1 cut(s) 167
AcyI GRCGYC 1 cut(s) 192
AgsI TTSAA 4 cut(s) 47, 58, 104, 205
AluBI AGCT 2 cut(s) 33, 109
AluI AGCT 2 cut(s) 33, 109
Alw21I GWGCWC 1 cut(s) 66
AlwI GGATC 1 cut(s) 23
AlwNI CAGNNNCTG 1 cut(s) 11
ApeKI GCWGC 1 cut(s) 259
ApoI RAATTY 1 cut(s) 167
ArsI GACNNNNNNTTYG 2 cut(s) 104, 136
Bbv12I GWGCWC 1 cut(s) 66
BfaI CTAG 1 cut(s) 110
BglII AGATCT 1 cut(s) 248
BisI GCNGC 1 cut(s) 260
BlsI GCNGC 1 cut(s) 261
BmrI ACTGGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 166
BmuI ACTGGG 1 cut(s) 21
Bpu10I CCTNAGC 2 cut(s) 34, 126
BsaHI GRCGYC 1 cut(s) 192
Bse1I ACTGG 1 cut(s) 16
BseGI GGATG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 16
BsiHKAI GWGCWC 1 cut(s) 66
Bsp1286I GDGCHC 1 cut(s) 66
Bsp143I GATC 2 cut(s) 15, 248
BspCNI CTCAG 1 cut(s) 139
BspHI TCATGA 1 cut(s) 213
BspPI GGATC 1 cut(s) 23
BsrI ACTGG 1 cut(s) 16
BssMI GATC 2 cut(s) 15, 248
BssNI GRCGYC 1 cut(s) 192
Bst4CI ACNGT 2 cut(s) 7, 231
BstACI GRCGYC 1 cut(s) 192
BstDEI CTNAG 2 cut(s) 34, 126
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 2 cut(s) 18, 251
BstMBI GATC 2 cut(s) 15, 248
BstX2I RGATCY 2 cut(s) 15, 248
BstYI RGATCY 2 cut(s) 15, 248
BtsCI GGATG 1 cut(s) 181
CaiI CAGNNNCTG 1 cut(s) 11
CciI TCATGA 1 cut(s) 213
CviAII CATG 2 cut(s) 116, 214
CviJI RGCY 2 cut(s) 33, 109
CviKI_1 RGCY 2 cut(s) 33, 109
DdeI CTNAG 2 cut(s) 34, 126
DpnI GATC 2 cut(s) 17, 250
DpnII GATC 2 cut(s) 15, 248
FaeI CATG 2 cut(s) 119, 217
FaiI YATR 4 cut(s) 68, 117, 141, 215
FatI CATG 2 cut(s) 115, 213
Fnu4HI GCNGC 1 cut(s) 260
FokI GGATG 1 cut(s) 188
Fsp4HI GCNGC 1 cut(s) 260
FspBI CTAG 1 cut(s) 110
GluI GCNGC 1 cut(s) 260
Hin1I GRCGYC 1 cut(s) 192
Hin1II CATG 2 cut(s) 119, 217
HinfI GANTC 1 cut(s) 50
Hpy188III TCNNGA 2 cut(s) 128, 214
HpyCH4III ACNGT 2 cut(s) 7, 231
HpyCH4IV ACGT 1 cut(s) 192
HpyCH4V TGCA 3 cut(s) 179, 185, 259
HpyF3I CTNAG 2 cut(s) 34, 126
HpySE526I ACGT 1 cut(s) 192
Hsp92I GRCGYC 1 cut(s) 192
Hsp92II CATG 2 cut(s) 119, 217
Kzo9I GATC 2 cut(s) 15, 248
LpnPI CCDG 4 cut(s) 113, 157, 159, 229
LweI GCATC 1 cut(s) 166
MaeI CTAG 1 cut(s) 110
MaeII ACGT 1 cut(s) 192
MaeIII GTNAC 2 cut(s) 7, 231
MalI GATC 2 cut(s) 17, 250
MboI GATC 2 cut(s) 15, 248
MboII GAAGA 1 cut(s) 59
MfeI CAATTG 1 cut(s) 254
MflI RGATCY 2 cut(s) 15, 248
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 3 cut(s) 133, 167, 254
MseI TTAA 1 cut(s) 197
MunI CAATTG 1 cut(s) 254
NdeII GATC 2 cut(s) 15, 248
NlaIII CATG 2 cut(s) 119, 217
PagI TCATGA 1 cut(s) 213
PfeI GAWTC 1 cut(s) 50
PkrI GCNGC 1 cut(s) 261
PsiI TTATAA 1 cut(s) 141
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 15, 248
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 1 cut(s) 260
Sau3AI GATC 2 cut(s) 15, 248
SduI GDGCHC 1 cut(s) 66
SetI ASST 3 cut(s) 35, 111, 195
SfaNI GCATC 1 cut(s) 166
Sse9I AATT 3 cut(s) 133, 167, 254
SspMI CTAG 1 cut(s) 110
TaaI ACNGT 2 cut(s) 7, 231
TaiI ACGT 1 cut(s) 195
TasI AATT 3 cut(s) 133, 167, 254
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TseI GCWGC 1 cut(s) 259
TspDTI ATGAA 2 cut(s) 41, 42
XapI RAATTY 1 cut(s) 167
XspI CTAG 1 cut(s) 110
ZraI GACGTC 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.