Rh2AG300700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
37600824 .. 37614522
13699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG300700.1

Sequence Viewer

Length: 237 bp
ATGGCTTCTTCATCACGGTCTTTTCCACCGCCACCTGATGGAGATCAGGGAAACACAGTGCTACATGCACTAGAGGCAGAAAAGCATCGACACCCAGAGATTGCTAATCTTAAGAGCCGCAAGGAAGATAAATTTTCAAAGGAAAAAGAATCCAGGCATAAAAGCTCTGATTTTTGGTGTGGGTGGAGGCTTTTAATTAGAATTGGAGTCAAGGGGAAGAGTAACATTTGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.96

Weight (kDa)

9.51

Isoelectric Point (pI)

57.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 38
AciI CCGC 2 cut(s) 29, 118
AcsI RAATTY 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 38
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 138
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
ApoI RAATTY 1 cut(s) 131
BccI CCATC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 154
BfaI CTAG 2 cut(s) 71, 235
BfrI CTTAAG 1 cut(s) 110
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 154
BmsI GCATC 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 42
BseBI CCWGG 1 cut(s) 154
BseJI GATNNNNATC 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 38
Bsp143I GATC 1 cut(s) 43
BspACI CCGC 2 cut(s) 29, 118
BspTI CTTAAG 1 cut(s) 110
BssMI GATC 1 cut(s) 43
Bst2UI CCWGG 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 18, 58
Bst6I CTCTTC 1 cut(s) 212
BstAFI CTTAAG 1 cut(s) 110
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 154
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 152
BtsIMutI CAGTG 1 cut(s) 63
CviAII CATG 1 cut(s) 65
CviJI RGCY 4 cut(s) 5, 117, 165, 190
CviKI_1 RGCY 4 cut(s) 5, 117, 165, 190
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 152
FaeI CATG 1 cut(s) 68
FaiI YATR 2 cut(s) 66, 159
FatI CATG 1 cut(s) 64
Fnu4HI GCNGC 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 118
FspBI CTAG 2 cut(s) 71, 235
GluI GCNGC 1 cut(s) 118
Hin1II CATG 1 cut(s) 68
HinfI GANTC 2 cut(s) 149, 207
Hpy188I TCNGA 1 cut(s) 169
HpyCH4III ACNGT 2 cut(s) 18, 58
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
Hsp92II CATG 1 cut(s) 68
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 5 cut(s) 32, 48, 108, 139, 166
LweI GCATC 1 cut(s) 94
MaeI CTAG 2 cut(s) 71, 235
MaeIII GTNAC 1 cut(s) 221
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 137, 229
MluCI AATT 3 cut(s) 131, 195, 201
MlyI GAGTC 1 cut(s) 216
MnlI CCTC 2 cut(s) 67, 180
MseI TTAA 2 cut(s) 111, 194
MspCI CTTAAG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 154
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 68
NspI RCATGY 1 cut(s) 68
PfeI GAWTC 1 cut(s) 149
PflMI CCANNNNNTGG 1 cut(s) 38
PkrI GCNGC 1 cut(s) 119
PleI GAGTC 1 cut(s) 215
PpsI GAGTC 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
SaqAI TTAA 2 cut(s) 111, 194
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 1 cut(s) 43
SchI GAGTC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 154
SetI ASST 2 cut(s) 37, 167
SfaNI GCATC 1 cut(s) 94
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 3 cut(s) 131, 195, 201
SsiI CCGC 2 cut(s) 29, 118
SspMI CTAG 2 cut(s) 71, 235
StyD4I CCNGG 1 cut(s) 152
TaaI ACNGT 2 cut(s) 18, 58
TaqI TCGA 1 cut(s) 88
TasI AATT 3 cut(s) 131, 195, 201
TauI GCSGC 1 cut(s) 120
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 2 cut(s) 111, 194
Tru9I TTAA 2 cut(s) 111, 194
TscAI CASTG 1 cut(s) 63
TspRI CASTG 1 cut(s) 63
Van91I CCANNNNNTGG 1 cut(s) 38
Vha464I CTTAAG 1 cut(s) 110
XapI RAATTY 1 cut(s) 131
XceI RCATGY 1 cut(s) 68
XspI CTAG 2 cut(s) 71, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.