Rh2CG441500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001543
Physical Location & Seq
Forward (+)
59820549 .. 59827820
7272 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG441500.1

Sequence Viewer

Length: 153 bp
ATGCCTCATTTGAGCTGGCCAATGTACGACTGGAGTACTGTTATGTGTATCCAACGTAAATGGAATTGGAGGCCAAAGAAGCAAGTTGCATTCAGAAATCCTAAGAATTCTATGTCAACTGAGAATGCAAGCAAGCCTATTTGGAGACCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

6.15

Weight (kDa)

10.63

Isoelectric Point (pI)

50.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 17
AcsI RAATTY 1 cut(s) 106
AfaI GTAC 2 cut(s) 26, 37
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 139
AoxI GGCC 2 cut(s) 17, 71
ApoI RAATTY 1 cut(s) 106
BalI TGGCCA 1 cut(s) 19
BciVI GTATCC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 139
BfuI GTATCC 1 cut(s) 59
BmcAI AGTACT 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 52
BsaI GGTCTC 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 35
BshFI GGCC 2 cut(s) 19, 73
BsmAI GTCTC 1 cut(s) 139
BsmI GAATGC 2 cut(s) 89, 130
BsnI GGCC 2 cut(s) 19, 73
Bso31I GGTCTC 1 cut(s) 139
BspANI GGCC 2 cut(s) 19, 73
BspCNI CTCAG 1 cut(s) 112
BspTNI GGTCTC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 40
BstC8I GCNNGC 3 cut(s) 17, 130, 134
BstDEI CTNAG 2 cut(s) 102, 120
BstMAI GTCTC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 79
BsuI GTATCC 1 cut(s) 59
BsuRI GGCC 2 cut(s) 19, 73
Cac8I GCNNGC 3 cut(s) 17, 130, 134
Csp6I GTAC 2 cut(s) 25, 36
CviJI RGCY 4 cut(s) 15, 19, 73, 136
CviKI_1 RGCY 4 cut(s) 15, 19, 73, 136
CviQI GTAC 2 cut(s) 25, 36
DdeI CTNAG 2 cut(s) 102, 120
EaeI YGGCCR 1 cut(s) 17
Eco31I GGTCTC 1 cut(s) 139
EcoRI GAATTC 1 cut(s) 106
FaiI YATR 2 cut(s) 44, 113
GsuI CTGGAG 1 cut(s) 52
HaeIII GGCC 2 cut(s) 19, 73
HincII GTYRAC 1 cut(s) 117
HindII GTYRAC 1 cut(s) 117
Hpy166II GTNNAC 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4IV ACGT 1 cut(s) 55
HpyCH4V TGCA 2 cut(s) 89, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 2 cut(s) 102, 120
HpySE526I ACGT 1 cut(s) 55
LpnPI CCDG 1 cut(s) 16
MaeII ACGT 1 cut(s) 55
MlsI TGGCCA 1 cut(s) 19
MluCI AATT 2 cut(s) 64, 106
MluNI TGGCCA 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 76
MnlI CCTC 2 cut(s) 15, 63
Mox20I TGGCCA 1 cut(s) 19
MscI TGGCCA 1 cut(s) 19
MseI TTAA 1 cut(s) 151
Msp20I TGGCCA 1 cut(s) 19
Mva1269I GAATGC 2 cut(s) 89, 130
MwoI GCNNNNNNNGC 1 cut(s) 79
PctI GAATGC 2 cut(s) 89, 130
RsaI GTAC 2 cut(s) 26, 37
RsaNI GTAC 2 cut(s) 25, 36
SaqAI TTAA 1 cut(s) 151
ScaI AGTACT 1 cut(s) 37
SetI ASST 3 cut(s) 17, 58, 151
SgeI CNNG 5 cut(s) 28, 43, 95, 141, 145
Sse9I AATT 2 cut(s) 64, 106
TaaI ACNGT 1 cut(s) 40
TaiI ACGT 1 cut(s) 58
TasI AATT 2 cut(s) 64, 106
TatI WGTACW 1 cut(s) 35
Tru1I TTAA 1 cut(s) 151
Tru9I TTAA 1 cut(s) 151
XapI RAATTY 1 cut(s) 106
XcmI CCANNNNNNNNNTGG 1 cut(s) 27
ZrmI AGTACT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.