RchiOBHm_Chr1g0381371

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66779265 .. 66779662
398 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 348 bp
ATGTTAGGTGGTGCTTGGAAAGTGATTCAGAAGATACAACATAGACACGTTTGGGATGTTCCTGAAAATGAAGAGGCATTCAATGTGGAATCAAACTACGATGATGATATAGACCAAGAAGATGAAGTTGGAACTGCAATGAATGTTCAAGAAAATATTGTGTATTCCAGTACACATTTACGTAGAGATGGTGTTCAACCTGAAACTGTCATCCTTTCCAACAAGGATATTGAACAAAGGATGTCCACAACTATTGATGATTTCATTGATGATGATTACATAGAGGAATTGCAATCTGAGGATGAGGAAAATAGTGTTCAGAGTGATGTTGATAGTGACTTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

115

Amino Acids

13.29

Weight (kDa)

4.05

Isoelectric Point (pI)

73.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 172
AflIII ACRYGT 1 cut(s) 46
AgsI TTSAA 4 cut(s) 82, 149, 197, 233
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
BccI CCATC 1 cut(s) 182
BsaAI YACGTR 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 168
Bse3DI GCAATG 1 cut(s) 144
BseGI GGATG 4 cut(s) 61, 210, 246, 307
BseMI GCAATG 1 cut(s) 144
BseMII CTCAG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 168
BsmI GAATGC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 289
BsrDI GCAATG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 208
Bst6I CTCTTC 1 cut(s) 66
BstBAI YACGTR 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 4 cut(s) 61, 210, 246, 307
BstSNI TACGTA 1 cut(s) 182
BtsCI GGATG 4 cut(s) 61, 210, 246, 307
Csp6I GTAC 1 cut(s) 171
CspCI CAANNNNNGTGG 2 cut(s) 235, 270
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 297
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
Eco105I TACGTA 1 cut(s) 182
FaiI YATR 3 cut(s) 42, 110, 281
FokI GGATG 4 cut(s) 68, 197, 253, 314
HinfI GANTC 2 cut(s) 25, 89
Hpy166II GTNNAC 2 cut(s) 173, 246
Hpy188I TCNGA 3 cut(s) 30, 298, 321
Hpy188III TCNNGA 2 cut(s) 62, 149
Hpy8I GTNNAC 2 cut(s) 173, 246
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 2 cut(s) 48, 181
HpyCH4V TGCA 2 cut(s) 137, 292
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 2 cut(s) 48, 181
LpnPI CCDG 3 cut(s) 75, 181, 213
MaeII ACGT 2 cut(s) 48, 181
MaeIII GTNAC 1 cut(s) 335
MboII GAAGA 3 cut(s) 43, 83, 131
MluCI AATT 2 cut(s) 287, 343
MmeI TCCRAC 2 cut(s) 109, 243
MnlI CCTC 4 cut(s) 67, 277, 292, 298
MseI TTAA 2 cut(s) 341, 346
Mva1269I GAATGC 1 cut(s) 77
NmuCI GTSAC 1 cut(s) 335
PctI GAATGC 1 cut(s) 77
PfeI GAWTC 2 cut(s) 25, 89
Ppu21I YACGTR 1 cut(s) 182
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
SaqAI TTAA 2 cut(s) 341, 346
SetI ASST 4 cut(s) 10, 51, 184, 202
SgeI CNNG 8 cut(s) 27, 59, 74, 128, 161, 180, 212, 235
SnaBI TACGTA 1 cut(s) 182
Sse9I AATT 2 cut(s) 287, 343
SspI AATATT 1 cut(s) 157
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 2 cut(s) 51, 184
TasI AATT 2 cut(s) 287, 343
TatI WGTACW 1 cut(s) 170
TfiI GAWTC 2 cut(s) 25, 89
Tru1I TTAA 2 cut(s) 341, 346
Tru9I TTAA 2 cut(s) 341, 346
TseFI GTSAC 1 cut(s) 335
Tsp45I GTSAC 1 cut(s) 335
TspDTI ATGAA 4 cut(s) 84, 138, 155, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.