RchiOBHm_Chr1g0318271

May be involved in modulation of pathogen defense and leaf cell death

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
5740450 .. 5743743
3294 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54856

Sequence Viewer

Length: 150 bp
ATGTTCGTGATGGTTTCAACAATGAAGAAGTCGATCTTTGATGAACAAACTAACAAGGCCTTAAGGAAATTGCAAAAGAATGCTCAAAAGAAGAGAAGGCATCATGATGTGGTTCGAGATGAATGGGCAAATCATGTTATACAGTTCTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.97

Weight (kDa)

10.37

Isoelectric Point (pI)

41.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 61
AgsI TTSAA 1 cut(s) 18
AoxI GGCC 1 cut(s) 57
BccI CCATC 1 cut(s) 4
BfrI CTTAAG 1 cut(s) 61
BmsI GCATC 1 cut(s) 109
BshFI GGCC 1 cut(s) 59
BsmI GAATGC 1 cut(s) 85
BsnI GGCC 1 cut(s) 59
Bsp143I GATC 1 cut(s) 33
BspANI GGCC 1 cut(s) 59
BspHI TCATGA 1 cut(s) 103
BspTI CTTAAG 1 cut(s) 61
BssMI GATC 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 86
BstAFI CTTAAG 1 cut(s) 61
BstKTI GATC 1 cut(s) 36
BstMBI GATC 1 cut(s) 33
BsuRI GGCC 1 cut(s) 59
CciI TCATGA 1 cut(s) 103
CviAII CATG 2 cut(s) 104, 134
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
Eco147I AGGCCT 1 cut(s) 59
FaeI CATG 2 cut(s) 107, 137
FaiI YATR 3 cut(s) 105, 135, 140
FalI AAGNNNNNCTT 2 cut(s) 20, 52
FatI CATG 2 cut(s) 103, 133
FspEI CC 7 cut(s) 41, 49, 73, 82, 95, 109, 110
HaeIII GGCC 1 cut(s) 59
Hin1II CATG 2 cut(s) 107, 137
Hpy188III TCNNGA 3 cut(s) 7, 104, 116
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 73
Hsp92II CATG 2 cut(s) 107, 137
Kzo9I GATC 1 cut(s) 33
LweI GCATC 1 cut(s) 109
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 2 cut(s) 37, 103
MluCI AATT 1 cut(s) 68
MseI TTAA 1 cut(s) 62
MslI CAYNNNNRTG 1 cut(s) 105
MspCI CTTAAG 1 cut(s) 61
Mva1269I GAATGC 1 cut(s) 85
NdeII GATC 1 cut(s) 33
NlaIII CATG 2 cut(s) 107, 137
PagI TCATGA 1 cut(s) 103
PceI AGGCCT 1 cut(s) 59
PctI GAATGC 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 1 cut(s) 62
Sau3AI GATC 1 cut(s) 33
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 5 cut(s) 19, 67, 116, 128, 146
SmiMI CAYNNNNRTG 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 1 cut(s) 68
SseBI AGGCCT 1 cut(s) 59
StuI AGGCCT 1 cut(s) 59
TaaI ACNGT 1 cut(s) 144
TaqI TCGA 2 cut(s) 32, 115
TasI AATT 1 cut(s) 68
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
TspDTI ATGAA 3 cut(s) 38, 57, 135
Vha464I CTTAAG 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.