RchiOBHm_Chr2g0167941

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001083
Physical Location & Seq
Forward (+)
82407175 .. 82408075
901 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53569

Sequence Viewer

Length: 189 bp
ATGAGAGCAGCACAGGAGTTCAGCTCAAGAACGTTTGATTCCATAAAGATGGTTTCAACAATGAAGAAGTCGATCTTTGATGAACAAACTAACAAGGCCTTAAGGAAATTGCAAAAGAATGCTCAAAAGAAGAATAAGCATCATGATGTGGTTCGAGCTGAATGGGCAAATCATGTTATACAGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.33

Weight (kDa)

10.28

Isoelectric Point (pI)

40.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 32
AflII CTTAAG 1 cut(s) 100
AgsI TTSAA 1 cut(s) 57
AluBI AGCT 2 cut(s) 24, 158
AluI AGCT 2 cut(s) 24, 158
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 1 cut(s) 8
BbvI GCAGC 1 cut(s) 20
BccI CCATC 1 cut(s) 43
BfrI CTTAAG 1 cut(s) 100
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
BmsI GCATC 1 cut(s) 148
BplI GAGNNNNNCTC 2 cut(s) 8, 40
BpuEI CTTGAG 1 cut(s) 10
BseXI GCAGC 1 cut(s) 20
BshFI GGCC 1 cut(s) 98
BsmI GAATGC 1 cut(s) 124
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 72
BspANI GGCC 1 cut(s) 98
BspHI TCATGA 1 cut(s) 142
BspTI CTTAAG 1 cut(s) 100
BssMI GATC 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 183
BstAFI CTTAAG 1 cut(s) 100
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstV1I GCAGC 1 cut(s) 20
BstXI CCANNNNNNTGG 1 cut(s) 49
BsuRI GGCC 1 cut(s) 98
CciI TCATGA 1 cut(s) 142
CviAII CATG 2 cut(s) 143, 173
CviJI RGCY 3 cut(s) 24, 98, 158
CviKI_1 RGCY 3 cut(s) 24, 98, 158
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eco147I AGGCCT 1 cut(s) 98
FaeI CATG 2 cut(s) 146, 176
FaiI YATR 4 cut(s) 44, 144, 174, 179
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FatI CATG 2 cut(s) 142, 172
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
FspEI CC 8 cut(s) 35, 55, 80, 88, 112, 134, 148, 149
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 2 cut(s) 146, 176
HinfI GANTC 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 27, 143
HpyCH4III ACNGT 1 cut(s) 183
HpyCH4IV ACGT 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpySE526I ACGT 1 cut(s) 32
Hsp92II CATG 2 cut(s) 146, 176
Kzo9I GATC 1 cut(s) 72
Lsp1109I GCAGC 1 cut(s) 20
LweI GCATC 1 cut(s) 148
MaeII ACGT 1 cut(s) 32
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 2 cut(s) 76, 142
MluCI AATT 1 cut(s) 107
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 2 cut(s) 47, 144
MspCI CTTAAG 1 cut(s) 100
Mva1269I GAATGC 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 1 cut(s) 72
NlaIII CATG 2 cut(s) 146, 176
PagI TCATGA 1 cut(s) 142
PceI AGGCCT 1 cut(s) 98
PctI GAATGC 1 cut(s) 124
PfeI GAWTC 1 cut(s) 38
PkrI GCNGC 1 cut(s) 10
Psp1406I AACGTT 1 cut(s) 32
RseI CAYNNNNRTG 2 cut(s) 47, 144
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 72
SetI ASST 3 cut(s) 26, 35, 160
SfaNI GCATC 1 cut(s) 148
SgeI CNNG 6 cut(s) 26, 39, 106, 155, 167, 185
SmiMI CAYNNNNRTG 2 cut(s) 47, 144
SmlI CTYRAG 2 cut(s) 25, 100
SmoI CTYRAG 2 cut(s) 25, 100
Sse9I AATT 1 cut(s) 107
SseBI AGGCCT 1 cut(s) 98
StuI AGGCCT 1 cut(s) 98
TaaI ACNGT 1 cut(s) 183
TaiI ACGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 71, 154
TasI AATT 1 cut(s) 107
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseI GCWGC 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 77, 96
Vha464I CTTAAG 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.