Rh5CG554800

Belongs to the glutamine synthetase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
77224680 .. 77242665
17986 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG554800.1

Sequence Viewer

Length: 216 bp
ATGGAGATAGAGTTCAAGTTGATTGTGGAATCTATGCTGAGTAAAGTAATGGAGGAGTTTCAGCATCGGCTAGCAAGCCAAACTGAACTGGTCATTGAGGATGATAAGCGTTTTCACATACAGGTCTACCTCGACTTTGGCTTGGCTATACCCAAGCTCAGTGTCCAAGGGATGGTATCTTCACCAAAAAGAACTTTTGGAGCTTGCTCCAATTAA

Protein Analysis

71

Amino Acids

8.15

Weight (kDa)

5.57

Isoelectric Point (pI)

59.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 172
AccI GTMKAC 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 1 cut(s) 16
AloI GAACNNNNNNTCC 1 cut(s) 28
AluBI AGCT 2 cut(s) 157, 203
AluI AGCT 2 cut(s) 157, 203
AsuHPI GGTGA 1 cut(s) 174
AsuNHI GCTAGC 1 cut(s) 70
BccI CCATC 1 cut(s) 166
BfaI CTAG 1 cut(s) 71
BmsI GCATC 1 cut(s) 73
BmtI GCTAGC 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 166
BsaXI ACNNNNNCTCC 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 2 cut(s) 106, 177
BseLI CCNNNNNNNGG 1 cut(s) 172
BseMII CTCAG 2 cut(s) 29, 172
BseNI ACTGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 172
BspCNI CTCAG 2 cut(s) 30, 171
BspOI GCTAGC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 166
BssT1I CCWWGG 1 cut(s) 166
BstC8I GCNNGC 3 cut(s) 72, 76, 205
BstDEI CTNAG 2 cut(s) 38, 158
BstF5I GGATG 2 cut(s) 106, 177
BtsCI GGATG 2 cut(s) 106, 177
BtsIMutI CAGTG 1 cut(s) 166
Cac8I GCNNGC 3 cut(s) 72, 76, 205
CviJI RGCY 6 cut(s) 70, 78, 141, 146, 157, 203
CviKI_1 RGCY 6 cut(s) 70, 78, 141, 146, 157, 203
DdeI CTNAG 2 cut(s) 38, 158
Eco130I CCWWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaiI YATR 3 cut(s) 35, 119, 149
FblI GTMKAC 1 cut(s) 126
FokI GGATG 2 cut(s) 113, 184
FspBI CTAG 1 cut(s) 71
HinfI GANTC 1 cut(s) 29
HphI GGTGA 1 cut(s) 174
Hpy166II GTNNAC 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 38, 158
LmnI GCTCC 2 cut(s) 200, 212
LpnPI CCDG 2 cut(s) 74, 107
LweI GCATC 1 cut(s) 73
MaeI CTAG 1 cut(s) 71
MboII GAAGA 1 cut(s) 171
MluCI AATT 1 cut(s) 211
MnlI CCTC 3 cut(s) 46, 91, 140
MseI TTAA 1 cut(s) 214
NheI GCTAGC 1 cut(s) 70
PfeI GAWTC 1 cut(s) 29
PflMI CCANNNNNTGG 1 cut(s) 172
SaqAI TTAA 1 cut(s) 214
SetI ASST 4 cut(s) 126, 132, 159, 205
SfaNI GCATC 1 cut(s) 73
SgeI CNNG 9 cut(s) 28, 83, 87, 101, 134, 143, 154, 166, 179
Sse9I AATT 1 cut(s) 211
SspMI CTAG 1 cut(s) 71
StyI CCWWGG 1 cut(s) 166
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 211
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TscAI CASTG 1 cut(s) 166
TspRI CASTG 1 cut(s) 166
Van91I CCANNNNNTGG 1 cut(s) 172
XmiI GTMKAC 1 cut(s) 126
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.