Rmu_sc0001563.1_g000026
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001563.1
Physical Location & Seq
Reverse (-)
95582 .. 97748
2167 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001563.1_g000026.1.cds

Sequence Viewer

Length: 297 bp
atgctgagtaaagtaatggaggagtttcagcatcggctagcaagccaaactgaactggtaaaagcaccttccaaagatagccctggccctgactctgagtctccatctctttctgaacctggttctggtgatatcaaggtcattgaggatgataagcgttttcacatacaggtctacctcgactttggcttggctatacccaagctcagtgtccaagggatggtatcttcactaaaagaacttttggagcttgctccaattaagaaggtaacagtatatctggttttcagttgttag

Protein Analysis

98

Amino Acids

10.81

Weight (kDa)

5.29

Isoelectric Point (pI)

53.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 220
AccI GTMKAC 1 cut(s) 174
AfiI CCNNNNNNNGG 2 cut(s) 125, 220
AhdI GACNNNNNGTC 1 cut(s) 97
AjnI CCWGG 2 cut(s) 82, 118
AluBI AGCT 2 cut(s) 205, 250
AluI AGCT 2 cut(s) 205, 250
Alw26I GTCTC 1 cut(s) 105
AoxI GGCC 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 140
AsuNHI GCTAGC 1 cut(s) 37
BccI CCATC 2 cut(s) 112, 214
BciT130I CCWGG 2 cut(s) 84, 120
BcoDI GTCTC 1 cut(s) 105
BfaI CTAG 1 cut(s) 38
Bme1390I CCNGG 2 cut(s) 84, 120
BmeRI GACNNNNNGTC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 86
BmrFI CCNGG 2 cut(s) 84, 120
BmsI GCATC 1 cut(s) 40
BmtI GCTAGC 1 cut(s) 41
BsaJI CCNNGG 2 cut(s) 82, 214
Bsc4I CCNNNNNNNGG 2 cut(s) 125, 220
Bse1I ACTGG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 84, 120
BseDI CCNNGG 2 cut(s) 82, 214
BseGI GGATG 2 cut(s) 154, 225
BseLI CCNNNNNNNGG 2 cut(s) 125, 220
BseMII CTCAG 2 cut(s) 87, 220
BseNI ACTGG 1 cut(s) 60
BseRI GAGGAG 1 cut(s) 35
BshFI GGCC 1 cut(s) 87
BslI CCNNNNNNNGG 2 cut(s) 125, 220
BsmAI GTCTC 1 cut(s) 105
BsnI GGCC 1 cut(s) 87
BspANI GGCC 1 cut(s) 87
BspCNI CTCAG 2 cut(s) 88, 219
BspOI GCTAGC 1 cut(s) 41
BsrI ACTGG 1 cut(s) 60
BssECI CCNNGG 2 cut(s) 82, 214
BssT1I CCWWGG 1 cut(s) 214
Bst2UI CCWGG 2 cut(s) 84, 120
Bst4CI ACNGT 1 cut(s) 274
BstC8I GCNNGC 3 cut(s) 39, 43, 252
BstDEI CTNAG 3 cut(s) 5, 96, 206
BstF5I GGATG 2 cut(s) 154, 225
BstMAI GTCTC 1 cut(s) 105
BstNI CCWGG 2 cut(s) 84, 120
BstSCI CCNGG 2 cut(s) 82, 118
BsuRI GGCC 1 cut(s) 87
BtsCI GGATG 2 cut(s) 154, 225
BtsIMutI CAGTG 1 cut(s) 214
Cac8I GCNNGC 3 cut(s) 39, 43, 252
Cfr13I GGNCC 1 cut(s) 86
CsiI ACCWGGT 1 cut(s) 118
CviJI RGCY 8 cut(s) 37, 45, 81, 87, 189, 194, 205, 250
CviKI_1 RGCY 8 cut(s) 37, 45, 81, 87, 189, 194, 205, 250
DdeI CTNAG 3 cut(s) 5, 96, 206
DriI GACNNNNNGTC 1 cut(s) 97
Eam1105I GACNNNNNGTC 1 cut(s) 97
Eco130I CCWWGG 1 cut(s) 214
Eco32I GATATC 1 cut(s) 133
EcoRII CCWGG 2 cut(s) 82, 118
EcoRV GATATC 1 cut(s) 133
EcoT14I CCWWGG 1 cut(s) 214
ErhI CCWWGG 1 cut(s) 214
FaiI YATR 3 cut(s) 167, 197, 277
FblI GTMKAC 1 cut(s) 174
FokI GGATG 2 cut(s) 161, 232
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 87
HinfI GANTC 2 cut(s) 92, 98
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 2 cut(s) 97, 115
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 2 cut(s) 78, 259
HpyCH4III ACNGT 1 cut(s) 274
HpyF3I CTNAG 3 cut(s) 5, 96, 206
LmnI GCTCC 2 cut(s) 247, 259
LpnPI CCDG 9 cut(s) 41, 69, 96, 102, 105, 111, 132, 155, 266
LweI GCATC 1 cut(s) 40
MabI ACCWGGT 1 cut(s) 118
MaeI CTAG 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 268
MboII GAAGA 1 cut(s) 219
MluCI AATT 1 cut(s) 258
MlyI GAGTC 2 cut(s) 86, 107
MnlI CCTC 3 cut(s) 13, 139, 188
MseI TTAA 1 cut(s) 261
MspR9I CCNGG 2 cut(s) 84, 120
MvaI CCWGG 2 cut(s) 84, 120
NheI GCTAGC 1 cut(s) 37
PflMI CCANNNNNTGG 1 cut(s) 220
PleI GAGTC 2 cut(s) 86, 106
PpsI GAGTC 2 cut(s) 86, 106
Psp6I CCWGG 2 cut(s) 82, 118
PspGI CCWGG 2 cut(s) 82, 118
PspPI GGNCC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 261
Sau96I GGNCC 1 cut(s) 86
SchI GAGTC 2 cut(s) 86, 107
ScrFI CCNGG 2 cut(s) 84, 120
SetI ASST 8 cut(s) 70, 121, 141, 174, 180, 207, 252, 270
SexAI ACCWGGT 1 cut(s) 118
SfaNI GCATC 1 cut(s) 40
Sse9I AATT 1 cut(s) 258
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 2 cut(s) 82, 118
StyI CCWWGG 1 cut(s) 214
TaaI ACNGT 1 cut(s) 274
TaqI TCGA 1 cut(s) 180
TasI AATT 1 cut(s) 258
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TscAI CASTG 1 cut(s) 214
TspRI CASTG 1 cut(s) 214
Van91I CCANNNNNTGG 1 cut(s) 220
XmiI GTMKAC 1 cut(s) 174
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.