RchiOBHm_Chr1g0364191

RNA recognition motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000611
Physical Location & Seq
Reverse (-)
55443788 .. 55444111
324 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58888

Sequence Viewer

Length: 324 bp
ATGTCCCACGACCACCTAGTCGAAGTCCTCGAAAATGCCGTCGTTGGCCACATGGTCGTCCTCGAATCCCTCCGCCACTTCACCAACCGTGACCTCACCCTTCGTAAGCTTTTCGTCCTCAGCCTCGGCTCTGACACCACCACTGATTCTCTCCACTTCGTCTTCTCCGCCTTCGGCTACCTCGACAAGGCCATCATCATATTCGACAAGGCCATCGGAAAATCCAAGGGCCACAGATTCGTCACCTTCAAGCACTCCGACGAAGTCCTTATCGACTACTTTGCCGCCACGCCTCTCCAGGCTGTCAAGCTCCTCGCCCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
RRM_1

Protein Analysis

107

Amino Acids

12.03

Weight (kDa)

6.64

Isoelectric Point (pI)

14.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 37 - 88 2.5e-06 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 17
AciI CCGC 3 cut(s) 73, 168, 285
AcoI YGGCCR 1 cut(s) 46
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 1 cut(s) 250
AjnI CCWGG 1 cut(s) 297
AluBI AGCT 2 cut(s) 109, 310
AluI AGCT 2 cut(s) 109, 310
AoxI GGCC 4 cut(s) 46, 189, 210, 229
ArsI GACNNNNNNTTYG 2 cut(s) 24, 56
AspS9I GGNCC 1 cut(s) 229
AsuHPI GGTGA 3 cut(s) 73, 88, 235
BalI TGGCCA 1 cut(s) 48
BbsI GAAGAC 1 cut(s) 154
BbvCI CCTCAGC 1 cut(s) 119
BccI CCATC 2 cut(s) 200, 221
BceAI ACGGC 1 cut(s) 23
BcgI CGANNNNNNTGC 2 cut(s) 263, 297
BciT130I CCWGG 1 cut(s) 299
BfaI CTAG 1 cut(s) 17
BisI GCNGC 1 cut(s) 285
BlsI GCNGC 1 cut(s) 286
Bme1390I CCNGG 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 229
BmrFI CCNGG 1 cut(s) 299
BpiI GAAGAC 1 cut(s) 154
BpmI CTGGAG 1 cut(s) 281
Bpu10I CCTNAGC 1 cut(s) 119
BsaJI CCNNGG 2 cut(s) 124, 225
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 299
BseDI CCNNGG 2 cut(s) 124, 225
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 302
BshFI GGCC 4 cut(s) 48, 191, 212, 231
BslI CCNNNNNNNGG 1 cut(s) 187
BsnI GGCC 4 cut(s) 48, 191, 212, 231
BspACI CCGC 3 cut(s) 73, 168, 285
BspANI GGCC 4 cut(s) 48, 191, 212, 231
BspCNI CTCAG 1 cut(s) 132
BssECI CCNNGG 2 cut(s) 124, 225
BssT1I CCWWGG 1 cut(s) 225
Bst2UI CCWGG 1 cut(s) 299
Bst4CI ACNGT 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 119
BstENI CCTNNNNNAGG 1 cut(s) 185
BstNI CCWGG 1 cut(s) 299
BstSCI CCNGG 1 cut(s) 297
BstV2I GAAGAC 1 cut(s) 154
BsuRI GGCC 4 cut(s) 48, 191, 212, 231
BtsIMutI CAGTG 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 229
CviAII CATG 1 cut(s) 52
DdeI CTNAG 1 cut(s) 119
DrdI GACNNNNNNGTC 1 cut(s) 17
DseDI GACNNNNNNGTC 1 cut(s) 17
EaeI YGGCCR 1 cut(s) 46
EciI GGCGGA 2 cut(s) 62, 157
Eco130I CCWWGG 1 cut(s) 225
EcoNI CCTNNNNNAGG 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 297
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 1 cut(s) 55
FaiI YATR 2 cut(s) 53, 200
FatI CATG 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 285
Fsp4HI GCNGC 1 cut(s) 285
FspBI CTAG 1 cut(s) 17
GluI GCNGC 1 cut(s) 285
GsuI CTGGAG 1 cut(s) 281
HaeIII GGCC 4 cut(s) 48, 191, 212, 231
Hin1II CATG 1 cut(s) 55
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 3 cut(s) 65, 146, 237
HphI GGTGA 3 cut(s) 73, 88, 235
Hpy188I TCNGA 3 cut(s) 133, 218, 259
Hpy99I CGWCG 2 cut(s) 44, 263
HpyAV CCTTC 3 cut(s) 110, 181, 256
HpyCH4III ACNGT 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 1 cut(s) 55
LmnI GCTCC 1 cut(s) 315
LpnPI CCDG 2 cut(s) 284, 311
MaeI CTAG 1 cut(s) 17
MaeIII GTNAC 2 cut(s) 89, 241
MboII GAAGA 1 cut(s) 154
MlsI TGGCCA 1 cut(s) 48
MluNI TGGCCA 1 cut(s) 48
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 9 cut(s) 38, 71, 80, 104, 128, 134, 191, 303, 323
Mox20I TGGCCA 1 cut(s) 48
MscI TGGCCA 1 cut(s) 48
Msp20I TGGCCA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 299
MvaI CCWGG 1 cut(s) 299
NlaIII CATG 1 cut(s) 55
NmeAIII GCCGAG 1 cut(s) 105
NmuCI GTSAC 2 cut(s) 89, 241
PcsI WCGNNNNNNNCGW 3 cut(s) 27, 36, 180
PfeI GAWTC 3 cut(s) 65, 146, 237
PflFI GACNNNGTC 1 cut(s) 263
PkrI GCNGC 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 297
PspGI CCWGG 1 cut(s) 297
PspPI GGNCC 1 cut(s) 229
PsyI GACNNNGTC 1 cut(s) 263
SatI GCNGC 1 cut(s) 285
Sau96I GGNCC 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 299
SetI ASST 6 cut(s) 18, 96, 111, 183, 248, 312
SsiI CCGC 3 cut(s) 73, 168, 285
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 297
StyI CCWWGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 89
TaqI TCGA 6 cut(s) 21, 30, 63, 183, 204, 273
TauI GCSGC 1 cut(s) 287
TfiI GAWTC 3 cut(s) 65, 146, 237
TscAI CASTG 1 cut(s) 148
TseFI GTSAC 2 cut(s) 89, 241
Tsp45I GTSAC 2 cut(s) 89, 241
TspRI CASTG 1 cut(s) 148
Tth111I GACNNNGTC 1 cut(s) 263
XagI CCTNNNNNAGG 1 cut(s) 185
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.