Rh4AG036900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
7980702 .. 7981005
304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG036900.1

Sequence Viewer

Length: 222 bp
ATGTTAAAGGAGGAGGGTTTTCTGGTAACTTGGGGAGGGAAAATATCTCCGGTCCCAGCTTCCTATAGAAGTTTCCTCACAAAGATCTGCCTTGAGCGATATGACGAGTTGGACGAGTTGAAAGCACGCCGGCAAAGAATCGTTCCGGCAATCCTGATAGTGTTTCTTTCCAATTGGTTGGGTTTTGATGTGAGGAAGCAGAACATGAATTTGGGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.49

Weight (kDa)

9.36

Isoelectric Point (pI)

48.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 208
AgsI TTSAA 1 cut(s) 121
AjuI GAANNNNNNNTTGG 1 cut(s) 194
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
ApoI RAATTY 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 52
AvaII GGWCC 1 cut(s) 52
BfmI CTRYAG 1 cut(s) 64
BglII AGATCT 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 54
BpuEI CTTGAG 1 cut(s) 113
BsaWI WCCGGW 1 cut(s) 49
Bse118I RCCGGY 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 26
BseYI CCCAGC 1 cut(s) 55
BsiSI CCGG 3 cut(s) 50, 130, 146
BslFI GGGAC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 84
BspLI GGNNCC 1 cut(s) 54
BsrFI RCCGGY 1 cut(s) 129
BssAI RCCGGY 1 cut(s) 129
BssMI GATC 1 cut(s) 84
BstC8I GCNNGC 2 cut(s) 127, 131
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstSFI CTRYAG 1 cut(s) 64
BstX2I RGATCY 1 cut(s) 84
BstXI CCANNNNNNTGG 1 cut(s) 178
BstYI RGATCY 1 cut(s) 84
Cac8I GCNNGC 2 cut(s) 127, 131
Cfr10I RCCGGY 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 52
CviAII CATG 1 cut(s) 205
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco47I GGWCC 1 cut(s) 52
FaeI CATG 1 cut(s) 208
FaiI YATR 3 cut(s) 66, 102, 206
FaqI GGGAC 1 cut(s) 38
FatI CATG 1 cut(s) 204
GsaI CCCAGC 1 cut(s) 59
HapII CCGG 3 cut(s) 50, 130, 146
Hin1II CATG 1 cut(s) 208
HinfI GANTC 1 cut(s) 138
HpaII CCGG 3 cut(s) 50, 130, 146
Hpy188III TCNNGA 1 cut(s) 154
Hsp92II CATG 1 cut(s) 208
KroI GCCGGC 1 cut(s) 129
KroNI GCCGGC 1 cut(s) 131
Kzo9I GATC 1 cut(s) 84
LpnPI CCDG 6 cut(s) 8, 63, 69, 143, 159, 167
MaeIII GTNAC 1 cut(s) 25
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MfeI CAATTG 1 cut(s) 172
MflI RGATCY 1 cut(s) 84
MluCI AATT 3 cut(s) 172, 208, 217
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 5 cut(s) 4, 7, 29, 86, 186
MroNI GCCGGC 1 cut(s) 129
MseI TTAA 1 cut(s) 5
MspI CCGG 3 cut(s) 50, 130, 146
MunI CAATTG 1 cut(s) 172
NaeI GCCGGC 1 cut(s) 131
NdeII GATC 1 cut(s) 84
NgoMIV GCCGGC 1 cut(s) 129
NlaIII CATG 1 cut(s) 208
NlaIV GGNNCC 1 cut(s) 54
PcsI WCGNNNNNNNCGW 1 cut(s) 111
PdiI GCCGGC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 138
PspFI CCCAGC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 84
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 52
SetI ASST 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 64
SinI GGWCC 1 cut(s) 52
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 3 cut(s) 172, 208, 217
TasI AATT 3 cut(s) 172, 208, 217
TfiI GAWTC 1 cut(s) 138
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 52
XapI RAATTY 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.