Rh1AG321800

RNA recognition motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0000611
Physical Location & Seq
Reverse (-)
55577848 .. 55578066
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG321800.1

Sequence Viewer

Length: 219 bp
ATGTCCCATGACCACCTAGTTGAAGTCCTCGACGACGCCGTCATTGGCCACACGGACGTCCTCGAATCCCTCTGCCACTTCACCAACCGTGACCTCACCCTTCGCAAGCTTTTCGTCCTCAGCCTCAGCGCTGACACCACCACCGATTCGTTATACTTCGTCTTCTTCGCCTTCGGCGACCTCGACAAGGCCATCGTCATATTCGACAAGGCCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
RRM_1

Protein Analysis

72

Amino Acids

8.11

Weight (kDa)

4.59

Isoelectric Point (pI)

17.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 38
AatII GACGTC 1 cut(s) 60
AcoI YGGCCR 1 cut(s) 46
AcyI GRCGYC 2 cut(s) 36, 57
AfeI AGCGCT 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Aor51HI AGCGCT 1 cut(s) 130
AoxI GGCC 3 cut(s) 46, 189, 210
AspLEI GCGC 1 cut(s) 131
AsuHPI GGTGA 2 cut(s) 73, 88
BalI TGGCCA 1 cut(s) 48
BbsI GAAGAC 1 cut(s) 154
BbvCI CCTCAGC 2 cut(s) 119, 125
BccI CCATC 1 cut(s) 200
BceAI ACGGC 1 cut(s) 23
BcgI CGANNNNNNTGC 2 cut(s) 94, 128
BfaI CTAG 1 cut(s) 17
BfoI RGCGCY 1 cut(s) 132
BpiI GAAGAC 1 cut(s) 154
Bpu10I CCTNAGC 2 cut(s) 119, 125
BsaHI GRCGYC 2 cut(s) 36, 57
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 2 cut(s) 133, 139
BshFI GGCC 3 cut(s) 48, 191, 212
BslI CCNNNNNNNGG 1 cut(s) 187
BsnI GGCC 3 cut(s) 48, 191, 212
BspANI GGCC 3 cut(s) 48, 191, 212
BspCNI CTCAG 2 cut(s) 132, 138
BssNI GRCGYC 2 cut(s) 36, 57
Bst4CI ACNGT 1 cut(s) 89
BstACI GRCGYC 2 cut(s) 36, 57
BstC8I GCNNGC 1 cut(s) 107
BstDEI CTNAG 2 cut(s) 119, 125
BstENI CCTNNNNNAGG 1 cut(s) 185
BstH2I RGCGCY 1 cut(s) 132
BstHHI GCGC 1 cut(s) 131
BstV2I GAAGAC 1 cut(s) 154
BsuRI GGCC 3 cut(s) 48, 191, 212
Cac8I GCNNGC 1 cut(s) 107
CfoI GCGC 1 cut(s) 131
CseI GACGC 1 cut(s) 44
CviAII CATG 1 cut(s) 8
CviJI RGCY 5 cut(s) 48, 109, 123, 191, 212
CviKI_1 RGCY 5 cut(s) 48, 109, 123, 191, 212
DdeI CTNAG 2 cut(s) 119, 125
DrdI GACNNNNNNGTC 1 cut(s) 38
DseDI GACNNNNNNGTC 1 cut(s) 38
EaeI YGGCCR 1 cut(s) 46
Eco47III AGCGCT 1 cut(s) 130
EcoNI CCTNNNNNAGG 1 cut(s) 185
FaeI CATG 1 cut(s) 11
FaiI YATR 3 cut(s) 9, 154, 200
FatI CATG 1 cut(s) 7
FspBI CTAG 1 cut(s) 17
GlaI GCGC 1 cut(s) 130
HaeII RGCGCY 1 cut(s) 132
HaeIII GGCC 3 cut(s) 48, 191, 212
HgaI GACGC 1 cut(s) 44
HhaI GCGC 1 cut(s) 131
Hin1I GRCGYC 2 cut(s) 36, 57
Hin1II CATG 1 cut(s) 11
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 2 cut(s) 65, 146
HphI GGTGA 2 cut(s) 73, 88
Hpy99I CGWCG 2 cut(s) 35, 38
HpyAV CCTTC 2 cut(s) 110, 181
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4IV ACGT 1 cut(s) 57
HpyF3I CTNAG 2 cut(s) 119, 125
HpySE526I ACGT 1 cut(s) 57
Hsp92I GRCGYC 2 cut(s) 36, 57
Hsp92II CATG 1 cut(s) 11
HspAI GCGC 1 cut(s) 129
MaeI CTAG 1 cut(s) 17
MaeII ACGT 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 89
MboII GAAGA 2 cut(s) 154, 157
MlsI TGGCCA 1 cut(s) 48
MluNI TGGCCA 1 cut(s) 48
MnlI CCTC 7 cut(s) 38, 71, 80, 104, 128, 134, 191
Mox20I TGGCCA 1 cut(s) 48
MscI TGGCCA 1 cut(s) 48
Msp20I TGGCCA 1 cut(s) 48
NlaIII CATG 1 cut(s) 11
NmuCI GTSAC 1 cut(s) 89
PcsI WCGNNNNNNNCGW 4 cut(s) 36, 174, 180, 201
PfeI GAWTC 2 cut(s) 65, 146
PflFI GACNNNGTC 1 cut(s) 38
PsyI GACNNNGTC 1 cut(s) 38
SetI ASST 6 cut(s) 18, 60, 96, 111, 183, 218
SgeI CNNG 9 cut(s) 20, 29, 41, 64, 74, 101, 118, 194, 199
SspMI CTAG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 89
TaiI ACGT 1 cut(s) 60
TaqI TCGA 4 cut(s) 30, 63, 183, 204
TfiI GAWTC 2 cut(s) 65, 146
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspGWI ACGGA 1 cut(s) 68
Tth111I GACNNNGTC 1 cut(s) 38
XagI CCTNNNNNAGG 1 cut(s) 185
XspI CTAG 1 cut(s) 17
ZraI GACGTC 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.