Rh1CG301300

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
57587820 .. 57588023
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG301300.1

Sequence Viewer

Length: 204 bp
ATGTCCCACGACCACGTAGTCGAAGTCGTCCAAAACGCCGTCGTTGGCAACACGGACGTCCTTGAATCCCTCTGCCACTTCACCAACCGTGACCTCACTCTTCTCAAGCTTTTCGTCCTCAGCCTCGGCGCTGACACCACCACCGATTCGCTCCACTTCGTCGACCTTGACAAGGCCATCGTCATATTCGACAAGGCCACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.38

Weight (kDa)

4.71

Isoelectric Point (pI)

6.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 17
AatII GACGTC 1 cut(s) 60
AccI GTMKAC 1 cut(s) 162
AcyI GRCGYC 1 cut(s) 57
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 1 cut(s) 65
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AoxI GGCC 2 cut(s) 174, 195
AspLEI GCGC 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 73
BbvCI CCTCAGC 1 cut(s) 119
BccI CCATC 1 cut(s) 185
BceAI ACGGC 1 cut(s) 23
BfoI RGCGCY 1 cut(s) 132
Bpu10I CCTNAGC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 89
BsaAI YACGTR 1 cut(s) 16
BsaHI GRCGYC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseDI CCNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 133
BshFI GGCC 2 cut(s) 176, 197
BslI CCNNNNNNNGG 1 cut(s) 172
BsnI GGCC 2 cut(s) 176, 197
BspANI GGCC 2 cut(s) 176, 197
BspCNI CTCAG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 124
BssNI GRCGYC 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 89
Bst6I CTCTTC 1 cut(s) 105
BstACI GRCGYC 1 cut(s) 57
BstBAI YACGTR 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 119
BstENI CCTNNNNNAGG 1 cut(s) 170
BstH2I RGCGCY 1 cut(s) 132
BstHHI GCGC 1 cut(s) 131
BsuRI GGCC 2 cut(s) 176, 197
CfoI GCGC 1 cut(s) 131
CviJI RGCY 4 cut(s) 109, 123, 176, 197
CviKI_1 RGCY 4 cut(s) 109, 123, 176, 197
DdeI CTNAG 1 cut(s) 119
DrdI GACNNNNNNGTC 1 cut(s) 17
DseDI GACNNNNNNGTC 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
EcoNI CCTNNNNNAGG 1 cut(s) 170
FaiI YATR 1 cut(s) 185
FblI GTMKAC 1 cut(s) 162
GlaI GCGC 1 cut(s) 130
HaeII RGCGCY 1 cut(s) 132
HaeIII GGCC 2 cut(s) 176, 197
HhaI GCGC 1 cut(s) 131
Hin1I GRCGYC 1 cut(s) 57
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HincII GTYRAC 1 cut(s) 163
HindII GTYRAC 1 cut(s) 163
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 2 cut(s) 65, 146
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 163
Hpy8I GTNNAC 1 cut(s) 163
Hpy99I CGWCG 2 cut(s) 44, 164
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4IV ACGT 2 cut(s) 15, 57
HpyF3I CTNAG 1 cut(s) 119
HpySE526I ACGT 2 cut(s) 15, 57
Hsp92I GRCGYC 1 cut(s) 57
HspAI GCGC 1 cut(s) 129
LmnI GCTCC 1 cut(s) 156
MaeII ACGT 2 cut(s) 15, 57
MaeIII GTNAC 1 cut(s) 89
MboII GAAGA 1 cut(s) 92
MnlI CCTC 4 cut(s) 80, 104, 128, 134
NmeAIII GCCGAG 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 186
PfeI GAWTC 2 cut(s) 65, 146
Ppu21I YACGTR 1 cut(s) 16
SalI GTCGAC 1 cut(s) 161
SetI ASST 6 cut(s) 18, 60, 96, 111, 168, 203
SgeI CNNG 9 cut(s) 20, 26, 64, 74, 101, 118, 137, 179, 184
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 89
TaiI ACGT 2 cut(s) 18, 60
TaqI TCGA 3 cut(s) 21, 162, 189
TfiI GAWTC 2 cut(s) 65, 146
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspGWI ACGGA 1 cut(s) 68
XagI CCTNNNNNAGG 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 162
ZraI GACGTC 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.