Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001359

Physical Location & Seq

Genomic Coordinates Reverse (-)

28866747 .. 28867818

Gene Structure 1072 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ44761

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

ATGGTTTGTCAGAGAAGAAGAGAAGACCTCTTTATAGGAAAAAATATTGGATTCGATATTAGATTAATTGATGTGAACCGGACTTGTAAAGTTACAAAGGGAGGGCAAGTGGTCAAATACACTGCTATATTAGTTTGTGGGAACTATCATGGTGTTGTTGGTTATGCTAAAGCAAAAGGTCCAGCCGTCCCTATTGCCCTCCAGAAGGCATATGAGAAATGCTTTCAGAATCTCCATCATGTAGAACGACATGAGGAGCATACAATTGCGCATGCAATACAAACTACATATAAAAAAACGAAGGTGTATCTCTGGCCTGCACCACTAGGACGGGTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S5 Ribosomal_S5_C

Protein Analysis

112

Amino Acids

12.72

Weight (kDa)

9.7

Isoelectric Point (pI)

35.89

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_S5	PF00333	19 - 82	2.9e-19	Ribosomal protein S5, N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001359)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64880
fragaria_vesca	FvH4_7g34290
malus_domestica	MD06G1015700.v1.1 MD07G1311200.v1.1 MD14G1141700.v1.1
prunus_persica	Prupe.2G329900_v2.0.a1 Prupe.2G329900_v2.0.a1
pyrus_communis	pycom07g28350
rosa_chinensis	RchiOBHm_Chr1g0384661 RchiOBHm_Chr3g0482781 RchiOBHm_Chr3g0482791 RchiOBHm_Chr3g0482801 RchiOBHm_Chr4g0404671
rosa_laevigata	RLG00000023329 RLG00000023333 RLG00000026022
rosa_multiflora	Rmu_co8059324.1_g000001 Rmu_co8197734.1_g000001 Rmu_co8237749.1_g000001 Rmu_co8374597.1_g000001 Rmu_sc0014854.1_g000001 Rmu_sc0026287.1_g000001
rosa_roxburghii	Rroxscaffold_2G00113600 Rroxscaffold_2G00131740 Rroxscaffold_3G00246900 Rroxscaffold_3G00264250 Rroxscaffold_4G00276480 Rroxscaffold_4G00310280 Rroxscaffold_5G00348850 Rroxscaffold_5G00354050 Rroxscaffold_6G00398930 Rroxscaffold_6G00398960 Rroxscaffold_7G00210840
rosa_rugosa	Rorug01G0450500 Rorug01G0450600 Rorug03G0198300 Rorug03G0198400 Rorug04G0048600
rosa_samantha	Rh1AG475100 Rh1BG433300 Rh1CG446500 Rh1CG446700 Rh1DG465800 Rh3AG249900 Rh3BG285100 Rh3BG285500 Rh3CG282800 Rh3CG283100 Rh3DG278600 Rh3DG278900 Rh4BG118500
rosa_wichuraiana	Rw1G039750 Rw3G022540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	270
AfiI	CCNNNNNNNGG	1 cut(s)	205
AoxI	GGCC	1 cut(s)	314
AseI	ATTAAT	1 cut(s)	65
AspLEI	GCGC	1 cut(s)	271
AspS9I	GGNCC	1 cut(s)	179
AvaII	GGWCC	1 cut(s)	179
BbsI	GAAGAC	1 cut(s)	30
BccI	CCATC	1 cut(s)	243
BceAI	ACGGC	1 cut(s)	170
BfaI	CTAG	1 cut(s)	326
Bme18I	GGWCC	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	179
BpiI	GAAGAC	1 cut(s)	30
BplI	GAGNNNNNCTC	2 cut(s)	12, 44
BpmI	CTGGAG	1 cut(s)	185
BsaWI	WCCGGW	1 cut(s)	78
BsaXI	ACNNNNNCTCC	2 cut(s)	93, 123
Bsc4I	CCNNNNNNNGG	1 cut(s)	205
BseLI	CCNNNNNNNGG	1 cut(s)	205
BseRI	GAGGAG	1 cut(s)	269
BsgI	GTGCAG	1 cut(s)	303
BshFI	GGCC	1 cut(s)	316
BsiSI	CCGG	1 cut(s)	79
BslFI	GGGAC	1 cut(s)	173
BslI	CCNNNNNNNGG	1 cut(s)	205
BsmFI	GGGAC	1 cut(s)	173
BsnI	GGCC	1 cut(s)	316
BspANI	GGCC	1 cut(s)	316
Bst6I	CTCTTC	1 cut(s)	13
BstC8I	GCNNGC	2 cut(s)	273, 318
BstENI	CCTNNNNNAGG	1 cut(s)	203
BstHHI	GCGC	1 cut(s)	271
BstNSI	RCATGY	1 cut(s)	275
BstV2I	GAAGAC	1 cut(s)	30
BsuRI	GGCC	1 cut(s)	316
BtsI	GCAGTG	1 cut(s)	120
BtsIMutI	CAGTG	1 cut(s)	120
Cac8I	GCNNGC	2 cut(s)	273, 318
CfoI	GCGC	1 cut(s)	271
Cfr13I	GGNCC	1 cut(s)	179
CviAII	CATG	4 cut(s)	149, 239, 251, 272
CviJI	RGCY	2 cut(s)	185, 316
CviKI_1	RGCY	2 cut(s)	185, 316
Eam1104I	CTCTTC	1 cut(s)	13
EarI	CTCTTC	1 cut(s)	13
Eco47I	GGWCC	1 cut(s)	179
EcoNI	CCTNNNNNAGG	1 cut(s)	203
FaeI	CATG	4 cut(s)	152, 242, 254, 275
FaqI	GGGAC	1 cut(s)	173
FatI	CATG	4 cut(s)	148, 238, 250, 271
FauNDI	CATATG	1 cut(s)	211
FspBI	CTAG	1 cut(s)	326
FspI	TGCGCA	1 cut(s)	270
GlaI	GCGC	1 cut(s)	270
GsuI	CTGGAG	1 cut(s)	185
HaeIII	GGCC	1 cut(s)	316
HapII	CCGG	1 cut(s)	79
HhaI	GCGC	1 cut(s)	271
Hin1II	CATG	4 cut(s)	152, 242, 254, 275
Hin6I	GCGC	1 cut(s)	269
HinP1I	GCGC	1 cut(s)	269
HinfI	GANTC	2 cut(s)	51, 229
HpaII	CCGG	1 cut(s)	79
Hpy166II	GTNNAC	1 cut(s)	76
Hpy188I	TCNGA	2 cut(s)	12, 228
Hpy188III	TCNNGA	1 cut(s)	202
Hpy8I	GTNNAC	1 cut(s)	76
HpyAV	CCTTC	2 cut(s)	199, 295
HpyCH4V	TGCA	2 cut(s)	275, 320
Hsp92II	CATG	4 cut(s)	152, 242, 254, 275
HspAI	GCGC	1 cut(s)	269
LmnI	GCTCC	1 cut(s)	256
LpnPI	CCDG	5 cut(s)	92, 195, 215, 298, 330
MaeI	CTAG	1 cut(s)	326
MaeIII	GTNAC	1 cut(s)	91
MboII	GAAGA	3 cut(s)	27, 30, 35
MfeI	CAATTG	1 cut(s)	264
MluCI	AATT	2 cut(s)	66, 264
MnlI	CCTC	4 cut(s)	38, 95, 209, 247
MseI	TTAA	1 cut(s)	65
MspI	CCGG	1 cut(s)	79
MunI	CAATTG	1 cut(s)	264
NdeI	CATATG	1 cut(s)	211
NlaIII	CATG	4 cut(s)	152, 242, 254, 275
NsbI	TGCGCA	1 cut(s)	270
NspI	RCATGY	1 cut(s)	275
PaeI	GCATGC	1 cut(s)	275
PfeI	GAWTC	2 cut(s)	51, 229
PshBI	ATTAAT	1 cut(s)	65
PspPI	GGNCC	1 cut(s)	179
SaqAI	TTAA	1 cut(s)	65
Sau96I	GGNCC	1 cut(s)	179
SetI	ASST	3 cut(s)	30, 181, 306
SinI	GGWCC	1 cut(s)	179
SphI	GCATGC	1 cut(s)	275
Sse9I	AATT	2 cut(s)	66, 264
SspI	AATATT	1 cut(s)	46
SspMI	CTAG	1 cut(s)	326
TaqI	TCGA	1 cut(s)	54
TasI	AATT	2 cut(s)	66, 264
TfiI	GAWTC	2 cut(s)	51, 229
Tru1I	TTAA	1 cut(s)	65
Tru9I	TTAA	1 cut(s)	65
TscAI	CASTG	1 cut(s)	127
TspRI	CASTG	1 cut(s)	127
VpaK11BI	GGWCC	1 cut(s)	179
VspI	ATTAAT	1 cut(s)	65
XagI	CCTNNNNNAGG	1 cut(s)	203
XceI	RCATGY	1 cut(s)	275
XspI	CTAG	1 cut(s)	326

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.