Rroxscaffold_5G00348850

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
21349290 .. 21350025
736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00348850.1

Sequence Viewer

Length: 168 bp
ATGAAGAGCCCACAGATTCTGGCCGGAAGCGACAATAACGACGAGTGGTTCAGTCCCAATGCCATCAGGAAGAGGGTTGATAAGTCTCAGAGGAAGTTCACGCGACACGAGGAATTGCTCAAGAATTTCACACAGGCTGTTCTCCACGGCATGGGGACTAGGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.44

Weight (kDa)

10.51

Isoelectric Point (pI)

45.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 151
AccII CGCG 1 cut(s) 103
AcoI YGGCCR 1 cut(s) 21
AcsI RAATTY 1 cut(s) 124
AfiI CCNNNNNNNGG 1 cut(s) 151
Alw26I GTCTC 1 cut(s) 90
AlwNI CAGNNNCTG 1 cut(s) 19
AoxI GGCC 1 cut(s) 21
ApoI RAATTY 1 cut(s) 124
BanII GRGCYC 1 cut(s) 11
BauI CACGAG 1 cut(s) 107
BccI CCATC 1 cut(s) 71
BceAI ACGGC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 90
BfaI CTAG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 145
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 101
Bsh1236I CGCG 1 cut(s) 103
BshFI GGCC 1 cut(s) 23
BsiSI CCGG 1 cut(s) 24
BslFI GGGAC 1 cut(s) 39
BslI CCNNNNNNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 39
BsnI GGCC 1 cut(s) 23
Bsp1286I GDGCHC 1 cut(s) 11
BspANI GGCC 1 cut(s) 23
BspCNI CTCAG 1 cut(s) 100
BspFNI CGCG 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 145
BssSI CACGAG 1 cut(s) 107
Bst2BI CACGAG 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 145
BstFNI CGCG 1 cut(s) 103
BstMAI GTCTC 1 cut(s) 90
BstUI CGCG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 23
BtgI CCRYGG 1 cut(s) 145
CaiI CAGNNNCTG 1 cut(s) 19
CviAII CATG 1 cut(s) 151
CviJI RGCY 3 cut(s) 9, 23, 137
CviKI_1 RGCY 3 cut(s) 9, 23, 137
DdeI CTNAG 1 cut(s) 87
EaeI YGGCCR 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
Eco24I GRGCYC 1 cut(s) 11
EcoT38I GRGCYC 1 cut(s) 11
FaeI CATG 1 cut(s) 154
FaiI YATR 1 cut(s) 152
FaqI GGGAC 1 cut(s) 39
FatI CATG 1 cut(s) 150
FriOI GRGCYC 1 cut(s) 11
FspBI CTAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 23
HapII CCGG 1 cut(s) 24
Hin1II CATG 1 cut(s) 154
HinfI GANTC 1 cut(s) 16
HpaII CCGG 1 cut(s) 24
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 2 cut(s) 67, 121
Hpy8I GTNNAC 1 cut(s) 99
Hpy99I CGWCG 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 1 cut(s) 154
LpnPI CCDG 4 cut(s) 5, 37, 52, 119
MaeI CTAG 1 cut(s) 159
MboII GAAGA 2 cut(s) 16, 82
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 2 cut(s) 113, 124
MnlI CCTC 3 cut(s) 66, 84, 103
MspI CCGG 1 cut(s) 24
MvnI CGCG 1 cut(s) 103
NlaIII CATG 1 cut(s) 154
PfeI GAWTC 1 cut(s) 16
PflMI CCANNNNNTGG 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 19
SduI GDGCHC 1 cut(s) 11
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 2 cut(s) 113, 124
SspMI CTAG 1 cut(s) 159
TasI AATT 2 cut(s) 113, 124
TfiI GAWTC 1 cut(s) 16
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 151
XapI RAATTY 1 cut(s) 124
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.