Rroxscaffold_3G00264250

Belongs to the universal ribosomal protein uS5 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001359
Physical Location & Seq
Reverse (-)
57961830 .. 57963623
1794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00264250.1

Sequence Viewer

Length: 393 bp
ATGAAGGAGAAAGATGACAAACTGTTAGAAAAACCAAATGCTATTGACAATAAACTTGAAGAAAAGCTAGCAGAGTTGGATCATACTTTTGGAAAGAAAGGAAAGGTTCTAGAGAAAGAAATCAGAGATCTAGCAGAGGAAAGAAAAGATTTGACGGAGAAGAAGAGAAGCCCTCTCTATAGAAAAGTATGTAAATGTATTAAGACGCTCCGACTACAGAAAATTATATATCCGCATGTCCTTGAATTCATGGGCATGGACTCCAAGAAGTGGTCAAAAGACAAAACCAATCAATTGAAATGGCCTGTTCTCAGAATAGCCAACATCCCATTTTCTGGAAAATATGGCCCTATATATATGTTGCATGCTCAGAATCATGGGTTCAATTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S5 Ribosomal_S5_C

Protein Analysis

130

Amino Acids

15.33

Weight (kDa)

9.58

Isoelectric Point (pI)

32.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 270, 335
AciI CCGC 1 cut(s) 233
AclWI GGATC 1 cut(s) 87
AcsI RAATTY 1 cut(s) 245
AfiI CCNNNNNNNGG 2 cut(s) 270, 335
AgsI TTSAA 4 cut(s) 59, 245, 298, 385
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AlwI GGATC 1 cut(s) 87
AoxI GGCC 2 cut(s) 302, 346
ApoI RAATTY 1 cut(s) 245
AspS9I GGNCC 1 cut(s) 347
AsuNHI GCTAGC 1 cut(s) 67
BfaI CTAG 3 cut(s) 68, 110, 131
BfmI CTRYAG 2 cut(s) 178, 215
BglII AGATCT 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 347
BmtI GCTAGC 1 cut(s) 71
BplI GAGNNNNNCTC 2 cut(s) 157, 189
Bsc4I CCNNNNNNNGG 2 cut(s) 270, 335
BseGI GGATG 1 cut(s) 324
BseLI CCNNNNNNNGG 2 cut(s) 270, 335
BseMII CTCAG 2 cut(s) 325, 383
BshFI GGCC 2 cut(s) 304, 348
BslI CCNNNNNNNGG 2 cut(s) 270, 335
BsnI GGCC 2 cut(s) 304, 348
Bsp143I GATC 2 cut(s) 79, 127
BspACI CCGC 1 cut(s) 233
BspANI GGCC 2 cut(s) 304, 348
BspCNI CTCAG 2 cut(s) 324, 382
BspHI TCATGA 1 cut(s) 389
BspOI GCTAGC 1 cut(s) 71
BspPI GGATC 1 cut(s) 87
BssMI GATC 2 cut(s) 79, 127
Bst4CI ACNGT 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 158
BstC8I GCNNGC 2 cut(s) 69, 366
BstDEI CTNAG 2 cut(s) 311, 369
BstF5I GGATG 1 cut(s) 324
BstKTI GATC 2 cut(s) 82, 130
BstMBI GATC 2 cut(s) 79, 127
BstNSI RCATGY 2 cut(s) 239, 368
BstSFI CTRYAG 2 cut(s) 178, 215
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BsuRI GGCC 2 cut(s) 304, 348
BtsCI GGATG 1 cut(s) 324
Cac8I GCNNGC 2 cut(s) 69, 366
CciI TCATGA 1 cut(s) 389
Cfr13I GGNCC 1 cut(s) 347
CseI GACGC 1 cut(s) 214
CviAII CATG 6 cut(s) 236, 250, 256, 365, 377, 390
CviJI RGCY 5 cut(s) 67, 171, 304, 320, 348
CviKI_1 RGCY 5 cut(s) 67, 171, 304, 320, 348
DdeI CTNAG 2 cut(s) 311, 369
DpnI GATC 2 cut(s) 81, 129
DpnII GATC 2 cut(s) 79, 127
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
EcoRI GAATTC 1 cut(s) 245
FaeI CATG 6 cut(s) 239, 253, 259, 368, 380, 393
FatI CATG 6 cut(s) 235, 249, 255, 364, 376, 389
FokI GGATG 1 cut(s) 311
FspBI CTAG 3 cut(s) 68, 110, 131
HaeIII GGCC 2 cut(s) 304, 348
HgaI GACGC 1 cut(s) 214
Hin1II CATG 6 cut(s) 239, 253, 259, 368, 380, 393
HinfI GANTC 2 cut(s) 260, 373
Hpy188I TCNGA 4 cut(s) 125, 212, 314, 372
Hpy188III TCNNGA 3 cut(s) 110, 336, 390
HpyCH4III ACNGT 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 364
HpyF3I CTNAG 2 cut(s) 311, 369
Hsp92II CATG 6 cut(s) 239, 253, 259, 368, 380, 393
Kzo9I GATC 2 cut(s) 79, 127
LmnI GCTCC 1 cut(s) 213
LpnPI CCDG 2 cut(s) 318, 321
MaeI CTAG 3 cut(s) 68, 110, 131
MalI GATC 2 cut(s) 81, 129
MboI GATC 2 cut(s) 79, 127
MboII GAAGA 3 cut(s) 71, 172, 175
MfeI CAATTG 1 cut(s) 293
MflI RGATCY 1 cut(s) 127
MluCI AATT 4 cut(s) 222, 245, 293, 385
MlyI GAGTC 1 cut(s) 254
MmeI TCCRAC 2 cut(s) 57, 235
MnlI CCTC 2 cut(s) 130, 183
MseI TTAA 1 cut(s) 201
MslI CAYNNNNRTG 1 cut(s) 254
MunI CAATTG 1 cut(s) 293
NdeII GATC 2 cut(s) 79, 127
NheI GCTAGC 1 cut(s) 67
NlaIII CATG 6 cut(s) 239, 253, 259, 368, 380, 393
NspI RCATGY 2 cut(s) 239, 368
PaeI GCATGC 1 cut(s) 368
PagI TCATGA 1 cut(s) 389
PfeI GAWTC 1 cut(s) 373
PflMI CCANNNNNTGG 2 cut(s) 270, 335
PleI GAGTC 1 cut(s) 254
PpsI GAGTC 1 cut(s) 254
PspPI GGNCC 1 cut(s) 347
PsuI RGATCY 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 254
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 2 cut(s) 79, 127
Sau96I GGNCC 1 cut(s) 347
SchI GAGTC 1 cut(s) 254
SetI ASST 2 cut(s) 69, 108
SfcI CTRYAG 2 cut(s) 178, 215
SmiMI CAYNNNNRTG 1 cut(s) 254
SphI GCATGC 1 cut(s) 368
Sse9I AATT 4 cut(s) 222, 245, 293, 385
SsiI CCGC 1 cut(s) 233
SspMI CTAG 3 cut(s) 68, 110, 131
TaaI ACNGT 1 cut(s) 24
TasI AATT 4 cut(s) 222, 245, 293, 385
TfiI GAWTC 1 cut(s) 373
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TspDTI ATGAA 3 cut(s) 17, 238, 378
TspGWI ACGGA 1 cut(s) 170
Van91I CCANNNNNTGG 2 cut(s) 270, 335
XapI RAATTY 1 cut(s) 245
XbaI TCTAGA 1 cut(s) 109
XceI RCATGY 2 cut(s) 239, 368
XspI CTAG 3 cut(s) 68, 110, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.