Rmu_co8059324.1_g000001

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8059324.1
Physical Location & Seq
Reverse (-)
2 .. 257
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8059324.1_g000001.1.cds

Sequence Viewer

Length: 256 bp
atgctggatttgaaaaagaaaaaaaaaattatccgagcttttgatgatgatgatgaagaagaattcaattacatcaaggaggaagatgacaccctgttagaaaagctaaatgctattgacaagaaacttgaagaaaagctagcaaagttggatcatacttttggaaagaaaggaaagcttctagaggaagagatcagagatctagcagtgaaaaaaaatgatttgacggagaagaagagaactctctatagaaaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

10.21

Weight (kDa)

6.61

Isoelectric Point (pI)

29.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 159
AcsI RAATTY 1 cut(s) 62
AgsI TTSAA 3 cut(s) 13, 67, 131
AluBI AGCT 4 cut(s) 38, 106, 139, 178
AluI AGCT 4 cut(s) 38, 106, 139, 178
AlwI GGATC 1 cut(s) 159
ApoI RAATTY 1 cut(s) 62
AsuNHI GCTAGC 1 cut(s) 139
BfaI CTAG 3 cut(s) 140, 182, 203
BfmI CTRYAG 1 cut(s) 247
BglII AGATCT 1 cut(s) 199
BmtI GCTAGC 1 cut(s) 143
Bsp143I GATC 3 cut(s) 151, 192, 199
BspOI GCTAGC 1 cut(s) 143
BspPI GGATC 1 cut(s) 159
BssMI GATC 3 cut(s) 151, 192, 199
Bst6I CTCTTC 2 cut(s) 183, 230
BstC8I GCNNGC 1 cut(s) 141
BstKTI GATC 3 cut(s) 154, 195, 202
BstMBI GATC 3 cut(s) 151, 192, 199
BstSFI CTRYAG 1 cut(s) 247
BstX2I RGATCY 1 cut(s) 199
BstYI RGATCY 1 cut(s) 199
BtsI GCAGTG 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 141
CviJI RGCY 4 cut(s) 38, 106, 139, 178
CviKI_1 RGCY 4 cut(s) 38, 106, 139, 178
DpnI GATC 3 cut(s) 153, 194, 201
DpnII GATC 3 cut(s) 151, 192, 199
Eam1104I CTCTTC 2 cut(s) 183, 230
EarI CTCTTC 2 cut(s) 183, 230
EcoRI GAATTC 1 cut(s) 62
FaiI YATR 2 cut(s) 156, 249
FalI AAGNNNNNCTT 2 cut(s) 162, 194
FspBI CTAG 3 cut(s) 140, 182, 203
HindIII AAGCTT 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 35, 197
Hpy188III TCNNGA 1 cut(s) 182
Kzo9I GATC 3 cut(s) 151, 192, 199
LpnPI CCDG 1 cut(s) 107
MaeI CTAG 3 cut(s) 140, 182, 203
MalI GATC 3 cut(s) 153, 194, 201
MboI GATC 3 cut(s) 151, 192, 199
MboII GAAGA 7 cut(s) 68, 71, 95, 143, 200, 244, 247
MflI RGATCY 1 cut(s) 199
MluCI AATT 3 cut(s) 27, 62, 67
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 2 cut(s) 73, 178
NdeII GATC 3 cut(s) 151, 192, 199
NheI GCTAGC 1 cut(s) 139
PsuI RGATCY 1 cut(s) 199
Sau3AI GATC 3 cut(s) 151, 192, 199
SetI ASST 4 cut(s) 40, 108, 141, 180
SfcI CTRYAG 1 cut(s) 247
SgeI CNNG 9 cut(s) 17, 47, 88, 106, 133, 140, 152, 194, 215
Sse9I AATT 3 cut(s) 27, 62, 67
SspMI CTAG 3 cut(s) 140, 182, 203
TasI AATT 3 cut(s) 27, 62, 67
TscAI CASTG 1 cut(s) 213
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 1 cut(s) 242
TspRI CASTG 1 cut(s) 213
XapI RAATTY 1 cut(s) 62
XbaI TCTAGA 1 cut(s) 181
XspI CTAG 3 cut(s) 140, 182, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.