Rw3G022540

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
27685832 .. 27686641
810 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G022540.1

Sequence Viewer

Length: 384 bp
ATGATGATGATGGATGAAGAATTCAATGACATGAAGGAGAAAGATGATATACTGTTAGAGAAGCTAAAATTTATCAACAAGAAACTAGAAGAGAAGCTAGCAGAGTTGGATCATACTTTTGGAAAGAAGGGAAAGGTTCTAGAGGAAGAGATCAGAGATCTAGCAGAGGAAAGAAATGGTTTGACGGAGAAGAAGAGAAGACCTCTTTATAAGAAAGGATTCGATGTTAGATTAATTGATGTGAACCGGACTTGTAAAGTTACAAAGGGAGGGCAAGTGGTCAAATACACTGCTATATTAGTTTGTGGGAACTATCATGGTGTTGTTGGTTATGCTAAAGCAAAAGGTCCAGTCCCTATTACCCTCCAGAAGGTGTATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.65

Weight (kDa)

9.11

Isoelectric Point (pI)

34.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S5 PF00333 74 - 117 6.8e-12 Ribosomal protein S5, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 210
AclWI GGATC 1 cut(s) 117
AcsI RAATTY 2 cut(s) 20, 68
AfiI CCNNNNNNNGG 1 cut(s) 370
AgsI TTSAA 1 cut(s) 25
AluBI AGCT 2 cut(s) 64, 97
AluI AGCT 2 cut(s) 64, 97
AlwI GGATC 1 cut(s) 117
ApoI RAATTY 2 cut(s) 20, 68
AseI ATTAAT 1 cut(s) 233
Asp700I GAANNNNTTC 1 cut(s) 218
AspS9I GGNCC 1 cut(s) 347
AsuNHI GCTAGC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 347
BbsI GAAGAC 1 cut(s) 205
BccI CCATC 1 cut(s) 4
BfaI CTAG 4 cut(s) 86, 98, 140, 161
BglII AGATCT 1 cut(s) 157
Bme18I GGWCC 1 cut(s) 347
BmgT120I GGNCC 1 cut(s) 347
BmtI GCTAGC 1 cut(s) 101
BpiI GAAGAC 1 cut(s) 205
BplI GAGNNNNNCTC 2 cut(s) 187, 219
BpmI CTGGAG 1 cut(s) 350
BsaWI WCCGGW 1 cut(s) 246
BsaXI ACNNNNNCTCC 2 cut(s) 261, 291
Bsc4I CCNNNNNNNGG 1 cut(s) 370
Bse1I ACTGG 1 cut(s) 350
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 370
BseNI ACTGG 1 cut(s) 350
BsiSI CCGG 1 cut(s) 247
BslFI GGGAC 1 cut(s) 338
BslI CCNNNNNNNGG 1 cut(s) 370
BsmFI GGGAC 1 cut(s) 338
Bsp143I GATC 3 cut(s) 109, 150, 157
BspOI GCTAGC 1 cut(s) 101
BspPI GGATC 1 cut(s) 117
BsrI ACTGG 1 cut(s) 350
BssMI GATC 3 cut(s) 109, 150, 157
Bst4CI ACNGT 1 cut(s) 54
Bst6I CTCTTC 3 cut(s) 84, 141, 188
BstC8I GCNNGC 1 cut(s) 99
BstENI CCTNNNNNAGG 1 cut(s) 368
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 3 cut(s) 112, 153, 160
BstMBI GATC 3 cut(s) 109, 150, 157
BstV2I GAAGAC 1 cut(s) 205
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BtsCI GGATG 1 cut(s) 19
BtsI GCAGTG 1 cut(s) 288
BtsIMutI CAGTG 1 cut(s) 288
Cac8I GCNNGC 1 cut(s) 99
Cfr13I GGNCC 1 cut(s) 347
CviAII CATG 2 cut(s) 31, 317
CviJI RGCY 2 cut(s) 64, 97
CviKI_1 RGCY 2 cut(s) 64, 97
DpnI GATC 3 cut(s) 111, 152, 159
DpnII GATC 3 cut(s) 109, 150, 157
Eam1104I CTCTTC 3 cut(s) 84, 141, 188
EarI CTCTTC 3 cut(s) 84, 141, 188
Eco47I GGWCC 1 cut(s) 347
EcoNI CCTNNNNNAGG 1 cut(s) 368
EcoRI GAATTC 1 cut(s) 20
FaeI CATG 2 cut(s) 34, 320
FaiI YATR 8 cut(s) 32, 50, 114, 210, 296, 318, 333, 378
FaqI GGGAC 1 cut(s) 338
FatI CATG 2 cut(s) 30, 316
FokI GGATG 1 cut(s) 26
FspBI CTAG 4 cut(s) 86, 98, 140, 161
GsuI CTGGAG 1 cut(s) 350
HapII CCGG 1 cut(s) 247
Hin1II CATG 2 cut(s) 34, 320
HinfI GANTC 1 cut(s) 219
HpaII CCGG 1 cut(s) 247
Hpy166II GTNNAC 1 cut(s) 244
Hpy188I TCNGA 1 cut(s) 155
Hpy188III TCNNGA 2 cut(s) 140, 367
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 3 cut(s) 28, 121, 364
HpyCH4III ACNGT 1 cut(s) 54
Hsp92II CATG 2 cut(s) 34, 320
Kzo9I GATC 3 cut(s) 109, 150, 157
LpnPI CCDG 3 cut(s) 260, 363, 380
MaeI CTAG 4 cut(s) 86, 98, 140, 161
MaeIII GTNAC 1 cut(s) 259
MalI GATC 3 cut(s) 111, 152, 159
MboI GATC 3 cut(s) 109, 150, 157
MboII GAAGA 6 cut(s) 29, 101, 158, 202, 205, 210
MflI RGATCY 1 cut(s) 157
MluCI AATT 3 cut(s) 20, 68, 234
MmeI TCCRAC 1 cut(s) 87
MnlI CCTC 5 cut(s) 136, 160, 213, 263, 374
MroXI GAANNNNTTC 1 cut(s) 218
MseI TTAA 1 cut(s) 233
MspI CCGG 1 cut(s) 247
NdeII GATC 3 cut(s) 109, 150, 157
NheI GCTAGC 1 cut(s) 97
NlaIII CATG 2 cut(s) 34, 320
PdmI GAANNNNTTC 1 cut(s) 218
PfeI GAWTC 1 cut(s) 219
PshBI ATTAAT 1 cut(s) 233
PsiI TTATAA 1 cut(s) 210
PspPI GGNCC 1 cut(s) 347
PsuI RGATCY 1 cut(s) 157
SaqAI TTAA 1 cut(s) 233
Sau3AI GATC 3 cut(s) 109, 150, 157
Sau96I GGNCC 1 cut(s) 347
SetI ASST 6 cut(s) 66, 99, 138, 205, 349, 375
SinI GGWCC 1 cut(s) 347
Sse9I AATT 3 cut(s) 20, 68, 234
SspMI CTAG 4 cut(s) 86, 98, 140, 161
TaaI ACNGT 1 cut(s) 54
TaqI TCGA 1 cut(s) 222
TasI AATT 3 cut(s) 20, 68, 234
TfiI GAWTC 1 cut(s) 219
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
TscAI CASTG 1 cut(s) 295
TspDTI ATGAA 2 cut(s) 30, 47
TspGWI ACGGA 1 cut(s) 200
TspRI CASTG 1 cut(s) 295
VpaK11BI GGWCC 1 cut(s) 347
VspI ATTAAT 1 cut(s) 233
XagI CCTNNNNNAGG 1 cut(s) 368
XapI RAATTY 2 cut(s) 20, 68
XbaI TCTAGA 1 cut(s) 139
XmnI GAANNNNTTC 1 cut(s) 218
XspI CTAG 4 cut(s) 86, 98, 140, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.