Rroxscaffold_5G00354050

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
32353732 .. 32354577
846 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00354050.1

Sequence Viewer

Length: 324 bp
ATGATCAACGTAGTGGTCTCCAACTTCGGCAGTCAAACCGCCGCCATTTACACCACCAAATCATACCCAATTCGAGAACCAATGCCCTCCTTTGTGGTTTTAAAGAAACGAGCTTGTCCTCGCATCAGCGAGGAAAGCCCCGCCTTATGCCCACATGACTCCGACGACACCCCCTATGATCCAAATGATCCTGCTAACTATGGAGTCATTCAAGAACAATCGAAGCCCTCATTTGATCTTCTAGAAGATGCTGGATTTGAAAAAGAAAAAAATAAATCATCCGAGCTGTTGATGATGATGATCAAGAAGAATTCAATGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.99

Weight (kDa)

5.08

Isoelectric Point (pI)

59.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 39, 42, 141
AclWI GGATC 2 cut(s) 173, 182
AcsI RAATTY 1 cut(s) 310
AgsI TTSAA 3 cut(s) 212, 260, 315
AluBI AGCT 2 cut(s) 113, 286
AluI AGCT 2 cut(s) 113, 286
Alw26I GTCTC 1 cut(s) 22
AlwI GGATC 2 cut(s) 173, 182
ApoI RAATTY 1 cut(s) 310
BclI TGATCA 2 cut(s) 3, 300
BcoDI GTCTC 1 cut(s) 22
BfaI CTAG 1 cut(s) 242
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
BmsI GCATC 2 cut(s) 132, 238
BsaBI GATNNNNATC 1 cut(s) 299
BsaI GGTCTC 1 cut(s) 22
Bse8I GATNNNNATC 1 cut(s) 299
BseGI GGATG 1 cut(s) 278
BseJI GATNNNNATC 1 cut(s) 299
BsmAI GTCTC 1 cut(s) 22
Bso31I GGTCTC 1 cut(s) 22
Bsp143I GATC 5 cut(s) 3, 178, 187, 235, 300
BspACI CCGC 3 cut(s) 39, 42, 141
BspPI GGATC 2 cut(s) 173, 182
BspTNI GGTCTC 1 cut(s) 22
BssMI GATC 5 cut(s) 3, 178, 187, 235, 300
BstF5I GGATG 1 cut(s) 278
BstKTI GATC 5 cut(s) 6, 181, 190, 238, 303
BstMAI GTCTC 1 cut(s) 22
BstMBI GATC 5 cut(s) 3, 178, 187, 235, 300
BstMWI GCNNNNNNNGC 1 cut(s) 135
BtsCI GGATG 1 cut(s) 278
CviAII CATG 2 cut(s) 155, 321
CviJI RGCY 4 cut(s) 113, 138, 226, 286
CviKI_1 RGCY 4 cut(s) 113, 138, 226, 286
DpnI GATC 5 cut(s) 5, 180, 189, 237, 302
DpnII GATC 5 cut(s) 3, 178, 187, 235, 300
DraI TTTAAA 1 cut(s) 102
Eco31I GGTCTC 1 cut(s) 22
EcoRI GAATTC 1 cut(s) 310
FaeI CATG 2 cut(s) 158, 324
FaiI YATR 6 cut(s) 64, 148, 156, 177, 201, 322
FatI CATG 2 cut(s) 154, 320
FauI CCCGC 1 cut(s) 148
FbaI TGATCA 2 cut(s) 3, 300
Fnu4HI GCNGC 1 cut(s) 42
FokI GGATG 1 cut(s) 265
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 1 cut(s) 242
GluI GCNGC 1 cut(s) 42
Hin1II CATG 2 cut(s) 158, 324
HinfI GANTC 2 cut(s) 158, 204
Hpy188I TCNGA 2 cut(s) 163, 283
Hpy188III TCNNGA 4 cut(s) 74, 212, 242, 304
Hpy99I CGWCG 1 cut(s) 167
HpyCH4IV ACGT 1 cut(s) 9
HpyF10VI GCNNNNNNNGC 1 cut(s) 135
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 2 cut(s) 158, 324
Ksp22I TGATCA 2 cut(s) 3, 300
Kzo9I GATC 5 cut(s) 3, 178, 187, 235, 300
LpnPI CCDG 2 cut(s) 204, 237
LweI GCATC 2 cut(s) 132, 238
MaeI CTAG 1 cut(s) 242
MaeII ACGT 1 cut(s) 9
MalI GATC 5 cut(s) 5, 180, 189, 237, 302
MboI GATC 5 cut(s) 3, 178, 187, 235, 300
MboII GAAGA 3 cut(s) 230, 257, 319
MluCI AATT 2 cut(s) 69, 310
MlyI GAGTC 2 cut(s) 152, 213
MmeI TCCRAC 2 cut(s) 45, 186
MnlI CCTC 4 cut(s) 97, 124, 129, 238
MseI TTAA 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 135
NdeII GATC 5 cut(s) 3, 178, 187, 235, 300
NlaIII CATG 2 cut(s) 158, 324
PkrI GCNGC 1 cut(s) 43
PleI GAGTC 2 cut(s) 152, 212
PpsI GAGTC 2 cut(s) 152, 212
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 5 cut(s) 3, 178, 187, 235, 300
SchI GAGTC 2 cut(s) 152, 213
SetI ASST 3 cut(s) 12, 115, 288
SfaNI GCATC 2 cut(s) 132, 238
Sse9I AATT 2 cut(s) 69, 310
SsiI CCGC 3 cut(s) 39, 42, 141
SspMI CTAG 1 cut(s) 242
TaiI ACGT 1 cut(s) 12
TaqI TCGA 2 cut(s) 73, 221
TasI AATT 2 cut(s) 69, 310
TauI GCSGC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
XapI RAATTY 1 cut(s) 310
XbaI TCTAGA 1 cut(s) 241
XspI CTAG 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.