Rroxscaffold_3G00246900

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
40210523 .. 40214552
4030 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00246900.1

Sequence Viewer

Length: 348 bp
ATGCTGGATTTGAAAAAGAAAAAAAAATTCATCCGAGTTGTTGATGATGATGATCAAGAAGAATTCAATGACATGAAGGAGAAAGATGACAAACTATTAGAAAAACCAAATGTTATTGACAAGAAACTTGAAGAAAAGCTAGCAGAGTTGGATCATACTTTTGGAAAGAAAGGAAAAGTTCTAGAGAAAGAGATCAGAGATCTAGCAGAGGAAAGAAATGATTTGACGGAGATGAAGAGAAGCCCTCTCTATAGAAAAGCAACTACAGATTTGGCTAATCCCAGGTATGACATGCTGGAGTATGCTGGAATCCTAGATGATATCAAAATGACTTTACGAACCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

13.67

Weight (kDa)

5.59

Isoelectric Point (pI)

31.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 159
AcsI RAATTY 2 cut(s) 26, 62
AgsI TTSAA 3 cut(s) 13, 67, 131
AjnI CCWGG 1 cut(s) 281
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AlwI GGATC 1 cut(s) 159
ApoI RAATTY 2 cut(s) 26, 62
AsuNHI GCTAGC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 283
BclI TGATCA 1 cut(s) 52
BfaI CTAG 4 cut(s) 140, 182, 203, 314
BfmI CTRYAG 2 cut(s) 250, 264
BglII AGATCT 1 cut(s) 199
Bme1390I CCNGG 1 cut(s) 283
BmrFI CCNGG 1 cut(s) 283
BmtI GCTAGC 1 cut(s) 143
BplI GAGNNNNNCTC 2 cut(s) 229, 261
BpmI CTGGAG 1 cut(s) 317
BsaBI GATNNNNATC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 281
Bse8I GATNNNNATC 1 cut(s) 51
BseBI CCWGG 1 cut(s) 283
BseDI CCNNGG 1 cut(s) 281
BseGI GGATG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 51
Bsp143I GATC 4 cut(s) 52, 151, 192, 199
BspOI GCTAGC 1 cut(s) 143
BspPI GGATC 1 cut(s) 159
BssECI CCNNGG 1 cut(s) 281
BssMI GATC 4 cut(s) 52, 151, 192, 199
Bst2UI CCWGG 1 cut(s) 283
Bst6I CTCTTC 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 141
BstF5I GGATG 1 cut(s) 30
BstKTI GATC 4 cut(s) 55, 154, 195, 202
BstMBI GATC 4 cut(s) 52, 151, 192, 199
BstNI CCWGG 1 cut(s) 283
BstNSI RCATGY 1 cut(s) 295
BstSCI CCNGG 1 cut(s) 281
BstSFI CTRYAG 2 cut(s) 250, 264
BstX2I RGATCY 1 cut(s) 199
BstYI RGATCY 1 cut(s) 199
BtsCI GGATG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 141
CviAII CATG 2 cut(s) 73, 292
CviJI RGCY 3 cut(s) 139, 243, 275
CviKI_1 RGCY 3 cut(s) 139, 243, 275
DpnI GATC 4 cut(s) 54, 153, 194, 201
DpnII GATC 4 cut(s) 52, 151, 192, 199
Eam1104I CTCTTC 1 cut(s) 230
EarI CTCTTC 1 cut(s) 230
Eco32I GATATC 1 cut(s) 322
EcoRI GAATTC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 281
EcoRV GATATC 1 cut(s) 322
FaeI CATG 2 cut(s) 76, 295
FaiI YATR 6 cut(s) 74, 156, 252, 288, 293, 303
FatI CATG 2 cut(s) 72, 291
FbaI TGATCA 1 cut(s) 52
FokI GGATG 1 cut(s) 17
FspBI CTAG 4 cut(s) 140, 182, 203, 314
GsuI CTGGAG 1 cut(s) 317
Hin1II CATG 2 cut(s) 76, 295
HinfI GANTC 1 cut(s) 309
Hpy188I TCNGA 2 cut(s) 35, 197
Hpy188III TCNNGA 2 cut(s) 56, 182
HpyAV CCTTC 1 cut(s) 70
Hsp92II CATG 2 cut(s) 76, 295
Ksp22I TGATCA 1 cut(s) 52
Kzo9I GATC 4 cut(s) 52, 151, 192, 199
LpnPI CCDG 4 cut(s) 268, 281, 291, 295
MaeI CTAG 4 cut(s) 140, 182, 203, 314
MalI GATC 4 cut(s) 54, 153, 194, 201
MboI GATC 4 cut(s) 52, 151, 192, 199
MboII GAAGA 3 cut(s) 71, 143, 247
MflI RGATCY 1 cut(s) 199
MluCI AATT 2 cut(s) 26, 62
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 2 cut(s) 202, 255
MspR9I CCNGG 1 cut(s) 283
MvaI CCWGG 1 cut(s) 283
NdeII GATC 4 cut(s) 52, 151, 192, 199
NheI GCTAGC 1 cut(s) 139
NlaIII CATG 2 cut(s) 76, 295
NspI RCATGY 1 cut(s) 295
PfeI GAWTC 1 cut(s) 309
Psp6I CCWGG 1 cut(s) 281
PspGI CCWGG 1 cut(s) 281
PsuI RGATCY 1 cut(s) 199
Sau3AI GATC 4 cut(s) 52, 151, 192, 199
ScrFI CCNGG 1 cut(s) 283
SetI ASST 2 cut(s) 141, 287
SfcI CTRYAG 2 cut(s) 250, 264
Sse9I AATT 2 cut(s) 26, 62
SspMI CTAG 4 cut(s) 140, 182, 203, 314
StyD4I CCNGG 1 cut(s) 281
TasI AATT 2 cut(s) 26, 62
TfiI GAWTC 1 cut(s) 309
TspDTI ATGAA 3 cut(s) 19, 89, 248
TspGWI ACGGA 1 cut(s) 242
XapI RAATTY 2 cut(s) 26, 62
XbaI TCTAGA 1 cut(s) 181
XceI RCATGY 1 cut(s) 295
XspI CTAG 4 cut(s) 140, 182, 203, 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.