Rh3DG278600

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
28261278 .. 28261659
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG278600.1

Sequence Viewer

Length: 273 bp
ATGAAAAGGGCTGGTCTCAACACCAAAGACATTGACCAAGAAGATGAGGAGGACTACATGCGTGTCACACCATTTATAGAGAAGCATGAGAAGGAGAAGCTCAAGACCGTTGGGGATCTCAATTCCTATGAGGAGCCCACCGATTCTGATAGTGATGATGACGAGGAGCAGTTCAGTCCCGATGCCATCAAGAAGAGGGTTGATGAGTTTCAGAGGAAGTTCATGCAACACAAGGAGTTGCTCAAGAATTTCACACAGGCTGATTCTGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.67

Weight (kDa)

4.59

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 247
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 20
AlwI GGATC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 247
BanII GRGCYC 1 cut(s) 138
BccI CCATC 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 135
BmsI GCATC 1 cut(s) 172
BpuEI CTTGAG 2 cut(s) 86, 227
BsaI GGTCTC 1 cut(s) 20
BseRI GAGGAG 3 cut(s) 62, 146, 179
BslFI GGGAC 1 cut(s) 162
BsmAI GTCTC 1 cut(s) 20
BsmFI GGGAC 1 cut(s) 162
Bso31I GGTCTC 1 cut(s) 20
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 135
BspPI GGATC 1 cut(s) 123
BspTNI GGTCTC 1 cut(s) 20
BssMI GATC 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 188
BstKTI GATC 1 cut(s) 118
BstMAI GTCTC 1 cut(s) 20
BstMBI GATC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 115
BstYI RGATCY 1 cut(s) 115
CviAII CATG 3 cut(s) 58, 86, 223
CviJI RGCY 4 cut(s) 11, 100, 136, 260
CviKI_1 RGCY 4 cut(s) 11, 100, 136, 260
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eam1104I CTCTTC 1 cut(s) 188
EarI CTCTTC 1 cut(s) 188
Eco24I GRGCYC 1 cut(s) 138
Eco31I GGTCTC 1 cut(s) 20
EcoT38I GRGCYC 1 cut(s) 138
FaeI CATG 3 cut(s) 61, 89, 226
FaiI YATR 5 cut(s) 59, 77, 87, 129, 224
FaqI GGGAC 1 cut(s) 162
FatI CATG 3 cut(s) 57, 85, 222
FriOI GRGCYC 1 cut(s) 138
Hin1II CATG 3 cut(s) 61, 89, 226
HinfI GANTC 2 cut(s) 143, 263
Hpy188I TCNGA 2 cut(s) 148, 213
Hpy188III TCNNGA 4 cut(s) 103, 179, 190, 244
HpyAV CCTTC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 226
Hsp92II CATG 3 cut(s) 61, 89, 226
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 2 cut(s) 133, 166
LpnPI CCDG 1 cut(s) 242
LweI GCATC 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 2 cut(s) 53, 205
MflI RGATCY 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 138
MluCI AATT 2 cut(s) 121, 247
MnlI CCTC 6 cut(s) 40, 43, 124, 157, 189, 207
NdeII GATC 1 cut(s) 115
NlaIII CATG 3 cut(s) 61, 89, 226
NlaIV GGNNCC 1 cut(s) 135
NmuCI GTSAC 1 cut(s) 64
NspI RCATGY 1 cut(s) 61
PfeI GAWTC 2 cut(s) 143, 263
PspN4I GGNNCC 1 cut(s) 135
PsuI RGATCY 1 cut(s) 115
Sau3AI GATC 1 cut(s) 115
SduI GDGCHC 1 cut(s) 138
SetI ASST 1 cut(s) 102
SfaNI GCATC 1 cut(s) 172
SmlI CTYRAG 2 cut(s) 101, 242
SmoI CTYRAG 2 cut(s) 101, 242
Sse9I AATT 2 cut(s) 121, 247
TaaI ACNGT 1 cut(s) 109
TasI AATT 2 cut(s) 121, 247
TfiI GAWTC 2 cut(s) 143, 263
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 17, 211
XapI RAATTY 1 cut(s) 247
XceI RCATGY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.