Rmu_sc0026287.1_g000001

Belongs to the universal ribosomal protein uS5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026287.1
Physical Location & Seq
Forward (+)
1 .. 3143
3143 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026287.1_g000001.1.cds

Sequence Viewer

Length: 227 bp
aaacctatgatccaaattatccttctaactatggagtcattcaagaacaactgaagccctcatttgatcttctagaagatgctagatttgaaaaagaaaaaaaattcatcccagctgttgatgatgatgatcaagaagaattcaatgacatgaaggagaaagatgacaaattgttagaaaagccaaatgctattgacaagaaacttgaagaaaagctagcagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.75

Weight (kDa)

4.39

Isoelectric Point (pI)

30.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 4
AcsI RAATTY 2 cut(s) 103, 139
AcuI CTGAAG 1 cut(s) 73
AgsI TTSAA 4 cut(s) 43, 91, 144, 208
AjuI GAANNNNNNNTTGG 1 cut(s) 38
AluBI AGCT 2 cut(s) 115, 216
AluI AGCT 2 cut(s) 115, 216
AlwI GGATC 1 cut(s) 4
ApoI RAATTY 2 cut(s) 103, 139
AsuNHI GCTAGC 1 cut(s) 216
BclI TGATCA 1 cut(s) 129
BfaI CTAG 3 cut(s) 73, 83, 217
BmsI GCATC 1 cut(s) 69
BmtI GCTAGC 1 cut(s) 220
BsaBI GATNNNNATC 1 cut(s) 128
Bse8I GATNNNNATC 1 cut(s) 128
BseGI GGATG 1 cut(s) 107
BseJI GATNNNNATC 1 cut(s) 128
BseYI CCCAGC 1 cut(s) 111
Bsp143I GATC 3 cut(s) 9, 66, 129
BspOI GCTAGC 1 cut(s) 220
BspPI GGATC 1 cut(s) 4
BssMI GATC 3 cut(s) 9, 66, 129
BstC8I GCNNGC 1 cut(s) 218
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 3 cut(s) 12, 69, 132
BstMBI GATC 3 cut(s) 9, 66, 129
BtsCI GGATG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 218
CviAII CATG 1 cut(s) 150
CviJI RGCY 4 cut(s) 57, 115, 183, 216
CviKI_1 RGCY 4 cut(s) 57, 115, 183, 216
DpnI GATC 3 cut(s) 11, 68, 131
DpnII GATC 3 cut(s) 9, 66, 129
Eco57I CTGAAG 1 cut(s) 73
EcoRI GAATTC 1 cut(s) 139
FaeI CATG 1 cut(s) 153
FaiI YATR 3 cut(s) 8, 32, 151
FatI CATG 1 cut(s) 149
FbaI TGATCA 1 cut(s) 129
FokI GGATG 1 cut(s) 94
FspBI CTAG 3 cut(s) 73, 83, 217
GsaI CCCAGC 1 cut(s) 115
Hin1II CATG 1 cut(s) 153
HinfI GANTC 1 cut(s) 35
Hpy188III TCNNGA 3 cut(s) 43, 73, 133
HpyAV CCTTC 2 cut(s) 32, 147
Hsp92II CATG 1 cut(s) 153
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 3 cut(s) 9, 66, 129
LpnPI CCDG 1 cut(s) 125
LweI GCATC 1 cut(s) 69
MaeI CTAG 3 cut(s) 73, 83, 217
MalI GATC 3 cut(s) 11, 68, 131
MboI GATC 3 cut(s) 9, 66, 129
MboII GAAGA 4 cut(s) 61, 88, 148, 220
MluCI AATT 4 cut(s) 15, 103, 139, 169
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 1 cut(s) 69
MspA1I CMGCKG 1 cut(s) 115
NdeII GATC 3 cut(s) 9, 66, 129
NheI GCTAGC 1 cut(s) 216
NlaIII CATG 1 cut(s) 153
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
PspFI CCCAGC 1 cut(s) 111
PvuII CAGCTG 1 cut(s) 115
Sau3AI GATC 3 cut(s) 9, 66, 129
SchI GAGTC 1 cut(s) 44
SetI ASST 3 cut(s) 7, 117, 218
SfaNI GCATC 1 cut(s) 69
SgeI CNNG 8 cut(s) 55, 85, 95, 124, 145, 162, 210, 217
Sse9I AATT 4 cut(s) 15, 103, 139, 169
SspMI CTAG 3 cut(s) 73, 83, 217
TasI AATT 4 cut(s) 15, 103, 139, 169
TspDTI ATGAA 2 cut(s) 96, 166
XapI RAATTY 2 cut(s) 103, 139
XbaI TCTAGA 1 cut(s) 72
XspI CTAG 3 cut(s) 73, 83, 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.