Rroxscaffold_6G00398930

Belongs to the universal ribosomal protein uS5 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0001359
Physical Location & Seq
Forward (+)
20824061 .. 20829322
5262 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00398930.1

Sequence Viewer

Length: 213 bp
ATGCGTGTCACACCATTTATAGAGAAGCTTGAGAAGGAGAAGCTCAAGACCATTGGGGATCTCAATTCCTATGAGGAGCCCACCGATTCTGATAGTGATGATGATGAGGAGCAGTTCAGTCCCGATGCCATCAAGAAGAGGGTTGATGAGTTTCAGAGGAAGTTCACGCAACACGAGGAGTTGCTCAAGAATTTCACACAGGCTGGTACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S5 Ribosomal_S5_C

Protein Analysis

70

Amino Acids

8.24

Weight (kDa)

4.59

Isoelectric Point (pI)

35.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 66
AcsI RAATTY 1 cut(s) 190
AfaI GTAC 1 cut(s) 208
AluBI AGCT 2 cut(s) 28, 43
AluI AGCT 2 cut(s) 28, 43
AlwI GGATC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 190
BanII GRGCYC 1 cut(s) 81
BauI CACGAG 1 cut(s) 173
BccI CCATC 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 78
BmsI GCATC 1 cut(s) 115
BpuEI CTTGAG 3 cut(s) 29, 50, 170
BseRI GAGGAG 3 cut(s) 89, 122, 191
BslFI GGGAC 1 cut(s) 105
BsmFI GGGAC 1 cut(s) 105
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 78
BspPI GGATC 1 cut(s) 66
BssMI GATC 1 cut(s) 58
BssSI CACGAG 1 cut(s) 173
Bst2BI CACGAG 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 131
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
Csp6I GTAC 1 cut(s) 207
CviJI RGCY 4 cut(s) 28, 43, 79, 203
CviKI_1 RGCY 4 cut(s) 28, 43, 79, 203
CviQI GTAC 1 cut(s) 207
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco24I GRGCYC 1 cut(s) 81
EcoT38I GRGCYC 1 cut(s) 81
FaiI YATR 3 cut(s) 20, 72, 211
FaqI GGGAC 1 cut(s) 105
FriOI GRGCYC 1 cut(s) 81
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 165
Hpy188I TCNGA 2 cut(s) 91, 156
Hpy188III TCNNGA 4 cut(s) 46, 122, 133, 187
Hpy8I GTNNAC 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 28
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 2 cut(s) 76, 109
LpnPI CCDG 2 cut(s) 185, 189
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 7
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 2 cut(s) 64, 190
MnlI CCTC 5 cut(s) 67, 100, 132, 150, 169
NdeII GATC 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 86
PspN4I GGNNCC 1 cut(s) 78
PsuI RGATCY 1 cut(s) 58
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
Sau3AI GATC 1 cut(s) 58
SduI GDGCHC 1 cut(s) 81
SetI ASST 2 cut(s) 30, 45
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 9 cut(s) 17, 41, 58, 134, 145, 178, 185, 187, 199
SmlI CTYRAG 3 cut(s) 29, 44, 185
SmoI CTYRAG 3 cut(s) 29, 44, 185
Sse9I AATT 2 cut(s) 64, 190
TasI AATT 2 cut(s) 64, 190
TfiI GAWTC 1 cut(s) 86
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
XapI RAATTY 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.