Rroxscaffold_2G00113600

Belongs to the universal ribosomal protein uS5 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001359
Physical Location & Seq
Forward (+)
39276460 .. 39277103
644 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00113600.1

Sequence Viewer

Length: 171 bp
ATGCAATTTGGATTATTGCTAGAACTTCAACACTACTGTCAGGTTGTTGGTTCAAGGAGTCCTCATAATACAGTGAAGACTGTTTTCGAAGCCCTTAATGAGACTGAAACTCCCAAGGATGTTCGAAGAAAGTTTGGGCGCACTGTTGTTGAGAAGTCCCTTCTATCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S5 Ribosomal_S5_C

Protein Analysis

56

Amino Acids

6.42

Weight (kDa)

9.03

Isoelectric Point (pI)

51.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S5_C PF03719 12 - 43 2.9e-07 Ribosomal protein S5, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 29, 54
Alw26I GTCTC 1 cut(s) 95
AspLEI GCGC 1 cut(s) 141
AsuII TTCGAA 2 cut(s) 87, 124
BbsI GAAGAC 1 cut(s) 83
BcoDI GTCTC 1 cut(s) 95
BfaI CTAG 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 83
Bpu14I TTCGAA 2 cut(s) 87, 124
BsaJI CCNNGG 1 cut(s) 114
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 124
BslFI GGGAC 1 cut(s) 142
BsmAI GTCTC 1 cut(s) 95
BsmFI GGGAC 1 cut(s) 142
Bsp119I TTCGAA 2 cut(s) 87, 124
BspT104I TTCGAA 2 cut(s) 87, 124
BssECI CCNNGG 1 cut(s) 114
BssT1I CCWWGG 1 cut(s) 114
Bst4CI ACNGT 4 cut(s) 38, 73, 82, 145
BstBI TTCGAA 2 cut(s) 87, 124
BstF5I GGATG 1 cut(s) 124
BstHHI GCGC 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 95
BstV2I GAAGAC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 124
BtsIMutI CAGTG 2 cut(s) 78, 141
CfoI GCGC 1 cut(s) 141
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
Eco130I CCWWGG 1 cut(s) 114
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaiI YATR 2 cut(s) 66, 169
FaqI GGGAC 1 cut(s) 142
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 20
GlaI GCGC 1 cut(s) 140
HhaI GCGC 1 cut(s) 141
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
HinfI GANTC 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 170
HpyCH4III ACNGT 4 cut(s) 38, 73, 82, 145
HpyCH4V TGCA 1 cut(s) 4
HspAI GCGC 1 cut(s) 139
LpnPI CCDG 1 cut(s) 26
MaeI CTAG 1 cut(s) 20
MboII GAAGA 2 cut(s) 88, 138
MluCI AATT 1 cut(s) 5
MlyI GAGTC 1 cut(s) 67
MnlI CCTC 1 cut(s) 72
MseI TTAA 1 cut(s) 96
NspV TTCGAA 2 cut(s) 87, 124
PleI GAGTC 1 cut(s) 66
PpsI GAGTC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 96
SchI GAGTC 1 cut(s) 67
SetI ASST 1 cut(s) 45
SfuI TTCGAA 2 cut(s) 87, 124
SgeI CNNG 4 cut(s) 32, 53, 66, 127
Sse9I AATT 1 cut(s) 5
SspMI CTAG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 114
TaaI ACNGT 4 cut(s) 38, 73, 82, 145
TaqI TCGA 2 cut(s) 87, 124
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TscAI CASTG 2 cut(s) 78, 148
TspRI CASTG 2 cut(s) 78, 148
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.