Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0002163

Physical Location & Seq

Genomic Coordinates Reverse (-)

58754613 .. 58756017

Gene Structure 1405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ26664

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

ATGGGAGGTGAAGGTGGAATGGGTGGGATGGATTTTTCAAAACTTGCTGGCATGGGAGGTGAAGGTGGAATGGGTGGGATGGATTTCTCGAAACTTGCTGGCATGGGAGGAGGTGATGATGCAATGGGTGACTTTGATGATAGCGATGATGGTAAGAAGACTATTAGCTTAATGATGAGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

60

Amino Acids

5.86

Weight (kDa)

4.05

Isoelectric Point (pI)

27.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002163)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0297061 RchiOBHm_Chr7g0200861 RchiOBHm_Chr7g0230581
rosa_laevigata	RLG00000007368 RLG00000011884 RLG00000013442 RLG00000017274 RLG00000017275 RLG00000017988 RLG00000034354
rosa_multiflora	Rmu_sc0001750.1_g000005 Rmu_sc0004217.1_g000002
rosa_roxburghii	Rroxscaffold_1G00047140 Rroxscaffold_2G00119870 Rroxscaffold_3G00251030 Rroxscaffold_4G00327060 Rroxscaffold_7G00214510
rosa_rugosa	Rorug02G0595700 Rorug02G0595700 Rorug03G0060600 Rorug03G0060700.1 Rorug03G0060800.1 Rorug05G0392400
rosa_samantha	Rh1AG166100 Rh1AG166200 Rh1AG166300 Rh1BG311800 Rh1CG154700 Rh1DG058100 Rh1DG343500 Rh2AG239200 Rh2AG239300 Rh2AG319700 Rh2CG016900 Rh3CG322700 Rh3DG271400 Rh4DG201000 Rh5DG159900 Rh6CG122200 Rh6CG122300 Rh6CG508600 Rh6DG109500 Rh7CG486800 Rh7DG455200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	39
AluBI	AGCT	1 cut(s)	168
AluI	AGCT	1 cut(s)	168
AsuHPI	GGTGA	4 cut(s)	20, 71, 125, 140
BbsI	GAAGAC	1 cut(s)	164
BccI	CCATC	3 cut(s)	22, 73, 143
BmsI	GCATC	1 cut(s)	109
BpiI	GAAGAC	1 cut(s)	164
Bse3DI	GCAATG	1 cut(s)	129
BseGI	GGATG	2 cut(s)	33, 84
BseMI	GCAATG	1 cut(s)	129
BseRI	GAGGAG	1 cut(s)	123
BsrDI	GCAATG	1 cut(s)	129
BstC8I	GCNNGC	2 cut(s)	49, 100
BstF5I	GGATG	2 cut(s)	33, 84
BstV2I	GAAGAC	1 cut(s)	164
BtgZI	GCGATG	1 cut(s)	159
BtsCI	GGATG	2 cut(s)	33, 84
Cac8I	GCNNGC	2 cut(s)	49, 100
CviAII	CATG	2 cut(s)	52, 103
CviJI	RGCY	1 cut(s)	168
CviKI_1	RGCY	1 cut(s)	168
FaeI	CATG	2 cut(s)	55, 106
FaiI	YATR	2 cut(s)	53, 104
FatI	CATG	2 cut(s)	51, 102
FokI	GGATG	2 cut(s)	40, 91
Hin1II	CATG	2 cut(s)	55, 106
HphI	GGTGA	4 cut(s)	20, 71, 125, 140
Hpy188III	TCNNGA	1 cut(s)	88
HpyAV	CCTTC	2 cut(s)	5, 56
HpyCH4V	TGCA	1 cut(s)	122
Hsp92II	CATG	2 cut(s)	55, 106
LpnPI	CCDG	2 cut(s)	33, 84
LweI	GCATC	1 cut(s)	109
MaeIII	GTNAC	1 cut(s)	128
MboII	GAAGA	1 cut(s)	169
MnlI	CCTC	3 cut(s)	50, 101, 104
MseI	TTAA	1 cut(s)	170
NlaIII	CATG	2 cut(s)	55, 106
NmuCI	GTSAC	1 cut(s)	128
SaqAI	TTAA	1 cut(s)	170
SetI	ASST	6 cut(s)	10, 16, 61, 67, 115, 170
SfaNI	GCATC	1 cut(s)	109
SgeI	CNNG	7 cut(s)	56, 60, 64, 100, 107, 111, 115
TaqI	TCGA	1 cut(s)	89
Tru1I	TTAA	1 cut(s)	170
Tru9I	TTAA	1 cut(s)	170
TseFI	GTSAC	1 cut(s)	128
Tsp45I	GTSAC	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.