Rh2AG319700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0002163
Physical Location & Seq
Forward (+)
45689093 .. 45690362
1270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG319700.1

Sequence Viewer

Length: 324 bp
ATGGCCACTTTGGATTTCAGCGTGAAATCTGGGGCAGGTCCTGTCATGATGACCCATGTCAAGAATTCGATATCAAACATGTCTTCTCTTCTCAATACCCAGAGGAATTGCACAACCCAGTTCTCATCCAGGATTCATTCCCGCAGGAGACCCAAAATAATAGCCTCCGTGGTCGTCGTCGCTCTCCACCACCTCCTACGCCGTCGCTCCCACCACCTCCTACGCCCTCTTTGGAAATATACAATAAAAGGTGATCAAGAAGAAGCTCCAGCCAATATGCAGTCTCCTATCCTAAATATGACAGATGATGTTGGGTGTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.05

Weight (kDa)

10.57

Isoelectric Point (pI)

74.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 26
AciI CCGC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 64
AflIII ACRYGT 1 cut(s) 78
AjnI CCWGG 1 cut(s) 128
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
Alw26I GTCTC 2 cut(s) 142, 288
AlwNI CAGNNNCTG 1 cut(s) 41
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 263
AvaII GGWCC 1 cut(s) 38
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 75
BceAI ACGGC 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 130
BclI TGATCA 1 cut(s) 253
BcoDI GTCTC 2 cut(s) 142, 288
BfuAI ACCTGC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 130
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 130
BmrI ACTGGG 1 cut(s) 112
BmuI ACTGGG 1 cut(s) 112
BoxI GACNNNNGTC 1 cut(s) 56
BpiI GAAGAC 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 252
BsaI GGTCTC 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 168
Bse1I ACTGG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 130
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 118
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 2 cut(s) 142, 288
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 253
BspACI CCGC 1 cut(s) 142
BspANI GGCC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 45
BspMI ACCTGC 1 cut(s) 26
BspTNI GGTCTC 1 cut(s) 142
BsrI ACTGG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 1 cut(s) 253
Bst2UI CCWGG 1 cut(s) 130
Bst6I CTCTTC 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 125
BstKTI GATC 1 cut(s) 256
BstMAI GTCTC 2 cut(s) 142, 288
BstMBI GATC 1 cut(s) 253
BstNI CCWGG 1 cut(s) 130
BstNSI RCATGY 1 cut(s) 82
BstPAI GACNNNNGTC 1 cut(s) 56
BstSCI CCNGG 1 cut(s) 128
BstV2I GAAGAC 1 cut(s) 75
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 168
BtsCI GGATG 1 cut(s) 125
BveI ACCTGC 1 cut(s) 26
CaiI CAGNNNCTG 1 cut(s) 41
CciI TCATGA 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 38
CviAII CATG 3 cut(s) 46, 56, 79
CviJI RGCY 4 cut(s) 5, 164, 266, 272
CviKI_1 RGCY 4 cut(s) 5, 164, 266, 272
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
Eco31I GGTCTC 1 cut(s) 142
Eco32I GATATC 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 38
EcoO109I RGGNCCY 1 cut(s) 38
EcoRI GAATTC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 128
EcoRV GATATC 1 cut(s) 72
FaeI CATG 3 cut(s) 49, 59, 82
FaiI YATR 6 cut(s) 47, 57, 80, 240, 278, 299
FatI CATG 3 cut(s) 45, 55, 78
FauI CCCGC 1 cut(s) 149
FbaI TGATCA 1 cut(s) 253
FokI GGATG 1 cut(s) 112
GsuI CTGGAG 1 cut(s) 252
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 3 cut(s) 49, 59, 82
HinfI GANTC 1 cut(s) 133
HphI GGTGA 1 cut(s) 263
Hpy188III TCNNGA 3 cut(s) 46, 61, 257
Hpy99I CGWCG 3 cut(s) 179, 182, 207
HpyCH4V TGCA 2 cut(s) 111, 280
Hsp92II CATG 3 cut(s) 49, 59, 82
Ksp22I TGATCA 1 cut(s) 253
Kzo9I GATC 1 cut(s) 253
LmnI GCTCC 2 cut(s) 212, 271
LpnPI CCDG 9 cut(s) 15, 21, 54, 113, 115, 130, 131, 142, 282
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 3 cut(s) 75, 80, 272
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 64, 106
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 5 cut(s) 96, 175, 203, 227, 237
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 130
NdeII GATC 1 cut(s) 253
NlaIII CATG 3 cut(s) 49, 59, 82
NspI RCATGY 1 cut(s) 82
PagI TCATGA 1 cut(s) 45
PciI ACATGT 1 cut(s) 78
PfeI GAWTC 1 cut(s) 133
PfoI TCCNGGA 1 cut(s) 128
PpuMI RGGWCCY 1 cut(s) 38
PscI ACATGT 1 cut(s) 78
PshAI GACNNNNGTC 1 cut(s) 56
Psp5II RGGWCCY 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 128
PspGI CCWGG 1 cut(s) 128
PspPI GGNCC 1 cut(s) 38
PspPPI RGGWCCY 1 cut(s) 38
PstNI CAGNNNCTG 1 cut(s) 41
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 130
SetI ASST 5 cut(s) 40, 195, 219, 253, 268
SinI GGWCC 1 cut(s) 38
Sse9I AATT 2 cut(s) 64, 106
SsiI CCGC 1 cut(s) 142
StyD4I CCNGG 1 cut(s) 128
TaqI TCGA 1 cut(s) 68
TasI AATT 2 cut(s) 64, 106
TfiI GAWTC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 125
TspGWI ACGGA 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 38
XapI RAATTY 1 cut(s) 64
XceI RCATGY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.