RchiOBHm_Chr7g0216841

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001371
Physical Location & Seq
Reverse (-)
34584468 .. 34587051
2584 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19404

Sequence Viewer

Length: 210 bp
ATGGTTCTTCCTTTTGAACCGCTCTCAGCTACATTTGATAAAATCAGATATGCTGTTGACATGCCACAGTTCAGACCATACGATAGAAGTTCCAGGGACCATAGTCCAGATGAAGCAAAGGGAAAGATTCAGGAGACAACTATTCATTTGCGGATTGAAAATCAGGGAGATAAAATGAACTGTGAAAATGGCGCAACTGAAGGCACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.88

Weight (kDa)

5.21

Isoelectric Point (pI)

60.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 22
AciI CCGC 2 cut(s) 20, 151
AgsI TTSAA 2 cut(s) 17, 158
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 128
AspLEI GCGC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 94
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 94
BoxI GACNNNNGTC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 93
BseMII CTCAG 1 cut(s) 39
BslFI GGGAC 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 110
BspACI CCGC 2 cut(s) 20, 151
BspCNI CTCAG 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 98
BsrBI CCGCTC 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 69, 182
BstDEI CTNAG 1 cut(s) 25
BstHHI GCGC 1 cut(s) 194
BstMAI GTCTC 1 cut(s) 128
BstNI CCWGG 1 cut(s) 94
BstNSI RCATGY 1 cut(s) 64
BstPAI GACNNNNGTC 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 92
CfoI GCGC 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 97
CviAII CATG 1 cut(s) 61
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DdeI CTNAG 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 64
FaiI YATR 5 cut(s) 51, 62, 79, 102, 208
FaqI GGGAC 1 cut(s) 110
FatI CATG 1 cut(s) 60
GlaI GCGC 1 cut(s) 193
HhaI GCGC 1 cut(s) 194
Hin1II CATG 1 cut(s) 64
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HinfI GANTC 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 58
Hpy188I TCNGA 2 cut(s) 47, 74
Hpy188III TCNNGA 2 cut(s) 107, 131
Hpy8I GTNNAC 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 69, 182
HpyF3I CTNAG 1 cut(s) 25
Hsp92II CATG 1 cut(s) 64
HspAI GCGC 1 cut(s) 192
LpnPI CCDG 5 cut(s) 79, 106, 116, 120, 149
MbiI CCGCTC 1 cut(s) 22
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 98
NspI RCATGY 1 cut(s) 64
PfeI GAWTC 1 cut(s) 127
PshAI GACNNNNGTC 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 97
Sau96I GGNCC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 94
SetI ASST 1 cut(s) 31
SgeI CNNG 6 cut(s) 73, 105, 106, 119, 143, 176
SinI GGWCC 1 cut(s) 97
SsiI CCGC 2 cut(s) 20, 151
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 2 cut(s) 69, 182
TfiI GAWTC 1 cut(s) 127
TspDTI ATGAA 3 cut(s) 126, 134, 191
VpaK11BI GGWCC 1 cut(s) 97
XceI RCATGY 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.