Rroxscaffold_5G00333390

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0001371
Physical Location & Seq
Forward (+)
809301 .. 812651
3351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00333390.1

Sequence Viewer

Length: 231 bp
ATGGTTCTTCCTTTTGAACCGCTCTCAGCTGCATCTGATAAAATCAGATATGCTGTTGACATGCCACAGTTCAGACCATACGATAGAAGTTCCAGGGACCATAGTCCAGATGAAGCAAAGGGAAAGATTCAGGAGACAACTATTCATTTGCGGATTGAAAATCAGGGAGATAAAATGAACTGTGAAAATGGCGCAACTGAAGGCACATATCTAGCAAAAAAGGTTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.6

Weight (kDa)

6.06

Isoelectric Point (pI)

51.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 22
AciI CCGC 2 cut(s) 20, 151
AcuI CTGAAG 1 cut(s) 219
AgsI TTSAA 2 cut(s) 17, 158
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 29
AspLEI GCGC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BbvI GCAGC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 1 cut(s) 212
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 94
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 41
BoxI GACNNNNGTC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 93
BseMII CTCAG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 16
BslFI GGGAC 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 110
BspACI CCGC 2 cut(s) 20, 151
BspCNI CTCAG 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 98
BsrBI CCGCTC 1 cut(s) 22
BssECI CCNNGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 69, 182
BstDEI CTNAG 1 cut(s) 25
BstHHI GCGC 1 cut(s) 194
BstMAI GTCTC 1 cut(s) 128
BstNI CCWGG 1 cut(s) 94
BstNSI RCATGY 1 cut(s) 64
BstPAI GACNNNNGTC 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 92
BstV1I GCAGC 1 cut(s) 16
CfoI GCGC 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 97
CviAII CATG 1 cut(s) 61
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DdeI CTNAG 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 219
EcoRII CCWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 64
FaiI YATR 5 cut(s) 51, 62, 79, 102, 208
FaqI GGGAC 1 cut(s) 110
FatI CATG 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 30
Fsp4HI GCNGC 1 cut(s) 30
FspBI CTAG 1 cut(s) 212
GlaI GCGC 1 cut(s) 193
GluI GCNGC 1 cut(s) 30
HhaI GCGC 1 cut(s) 194
Hin1II CATG 1 cut(s) 64
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HinfI GANTC 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 58
Hpy188I TCNGA 3 cut(s) 37, 47, 74
Hpy188III TCNNGA 2 cut(s) 107, 131
Hpy8I GTNNAC 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 69, 182
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 25
Hsp92II CATG 1 cut(s) 64
HspAI GCGC 1 cut(s) 192
LpnPI CCDG 5 cut(s) 79, 106, 116, 120, 149
Lsp1109I GCAGC 1 cut(s) 16
LweI GCATC 1 cut(s) 41
MaeI CTAG 1 cut(s) 212
MbiI CCGCTC 1 cut(s) 22
MspA1I CMGCKG 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 98
NspI RCATGY 1 cut(s) 64
PfeI GAWTC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 31
PshAI GACNNNNGTC 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 97
PvuII CAGCTG 1 cut(s) 29
SatI GCNGC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 94
SetI ASST 2 cut(s) 31, 225
SfaNI GCATC 1 cut(s) 41
SgeI CNNG 7 cut(s) 73, 105, 106, 119, 143, 176, 224
SinI GGWCC 1 cut(s) 97
SsiI CCGC 2 cut(s) 20, 151
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 2 cut(s) 69, 182
TfiI GAWTC 1 cut(s) 127
TseI GCWGC 1 cut(s) 29
TspDTI ATGAA 3 cut(s) 126, 134, 191
VpaK11BI GGWCC 1 cut(s) 97
XceI RCATGY 1 cut(s) 64
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.