Rw5G035440
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
61360824 .. 61362697
1874 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G035440.1

Sequence Viewer

Length: 357 bp
ATGGCAAAGAAACAATCCACCAAAATTGGAGAGGCCGTTGAATTATTGTCAACAGGAAAGAGCTATATTAGTGCAACTAATGAAAGACTAGACAATGTGTTCGGCAATCTCACCAATCAGCGAGGAATGGTTCTTCCTTTTGAACCGCTCTCACCTACATCTGATAAAATCAGATATGCTGTTGACATGCCACAGTTCAGACCATACGATAGAAGTTCCAGGGACCATAGTCCAGATGAAGCAAAGGGAAAGATTCAAGAGACAACTATTCATTTGAGGATTGAAAATCAGGGAGATAAAATGAATTGTGAAAATGGCGCAACTGAAGGCACATATCTAGCAGAAAAGGTTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

118

Amino Acids

13.21

Weight (kDa)

6.12

Isoelectric Point (pI)

39.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 148
AciI CCGC 1 cut(s) 146
AcuI CTGAAG 1 cut(s) 345
AgsI TTSAA 4 cut(s) 41, 143, 257, 284
AjnI CCWGG 1 cut(s) 218
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw26I GTCTC 1 cut(s) 254
AoxI GGCC 1 cut(s) 33
ArsI GACNNNNNNTTYG 2 cut(s) 83, 115
AspLEI GCGC 1 cut(s) 320
AspS9I GGNCC 1 cut(s) 223
AsuHPI GGTGA 2 cut(s) 103, 144
AvaII GGWCC 1 cut(s) 223
BceAI ACGGC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 220
BcoDI GTCTC 1 cut(s) 254
BfaI CTAG 2 cut(s) 89, 338
Bme1390I CCNGG 1 cut(s) 220
Bme18I GGWCC 1 cut(s) 223
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 220
BoxI GACNNNNGTC 1 cut(s) 228
BsaJI CCNNGG 1 cut(s) 219
BsaXI ACNNNNNCTCC 2 cut(s) 21, 51
BseBI CCWGG 1 cut(s) 220
BseDI CCNNGG 1 cut(s) 219
BshFI GGCC 1 cut(s) 35
BslFI GGGAC 1 cut(s) 236
BsmAI GTCTC 1 cut(s) 254
BsmFI GGGAC 1 cut(s) 236
BsnI GGCC 1 cut(s) 35
BspACI CCGC 1 cut(s) 146
BspANI GGCC 1 cut(s) 35
BspLI GGNNCC 1 cut(s) 224
BsrBI CCGCTC 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 219
Bst2UI CCWGG 1 cut(s) 220
Bst4CI ACNGT 1 cut(s) 195
BstHHI GCGC 1 cut(s) 320
BstMAI GTCTC 1 cut(s) 254
BstNI CCWGG 1 cut(s) 220
BstNSI RCATGY 1 cut(s) 190
BstPAI GACNNNNGTC 1 cut(s) 228
BstSCI CCNGG 1 cut(s) 218
BsuRI GGCC 1 cut(s) 35
CfoI GCGC 1 cut(s) 320
Cfr13I GGNCC 1 cut(s) 223
CspCI CAANNNNNGTGG 2 cut(s) 7, 42
CviAII CATG 1 cut(s) 187
CviJI RGCY 2 cut(s) 35, 63
CviKI_1 RGCY 2 cut(s) 35, 63
Eco47I GGWCC 1 cut(s) 223
Eco57I CTGAAG 1 cut(s) 345
EcoRII CCWGG 1 cut(s) 218
FaeI CATG 1 cut(s) 190
FaiI YATR 6 cut(s) 66, 177, 188, 205, 228, 334
FaqI GGGAC 1 cut(s) 236
FatI CATG 1 cut(s) 186
FspBI CTAG 2 cut(s) 89, 338
GlaI GCGC 1 cut(s) 319
HaeIII GGCC 1 cut(s) 35
HhaI GCGC 1 cut(s) 320
Hin1II CATG 1 cut(s) 190
Hin6I GCGC 1 cut(s) 318
HinP1I GCGC 1 cut(s) 318
HincII GTYRAC 2 cut(s) 51, 184
HindII GTYRAC 2 cut(s) 51, 184
HinfI GANTC 1 cut(s) 253
HphI GGTGA 2 cut(s) 103, 144
Hpy166II GTNNAC 2 cut(s) 51, 184
Hpy188I TCNGA 3 cut(s) 163, 173, 200
Hpy188III TCNNGA 2 cut(s) 233, 257
Hpy8I GTNNAC 2 cut(s) 51, 184
HpyAV CCTTC 1 cut(s) 320
HpyCH4III ACNGT 1 cut(s) 195
HpyCH4V TGCA 1 cut(s) 74
Hsp92II CATG 1 cut(s) 190
HspAI GCGC 1 cut(s) 318
LpnPI CCDG 5 cut(s) 39, 205, 232, 246, 275
MaeI CTAG 2 cut(s) 89, 338
MbiI CCGCTC 1 cut(s) 148
MboII GAAGA 1 cut(s) 125
MluCI AATT 3 cut(s) 24, 41, 304
MnlI CCTC 3 cut(s) 25, 116, 270
MspR9I CCNGG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 220
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 1 cut(s) 224
NspI RCATGY 1 cut(s) 190
PfeI GAWTC 1 cut(s) 253
PshAI GACNNNNGTC 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 218
PspGI CCWGG 1 cut(s) 218
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 223
Sau96I GGNCC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 220
SetI ASST 3 cut(s) 65, 157, 351
SinI GGWCC 1 cut(s) 223
Sse9I AATT 3 cut(s) 24, 41, 304
SsiI CCGC 1 cut(s) 146
SspMI CTAG 2 cut(s) 89, 338
StyD4I CCNGG 1 cut(s) 218
TaaI ACNGT 1 cut(s) 195
TasI AATT 3 cut(s) 24, 41, 304
TfiI GAWTC 1 cut(s) 253
TspDTI ATGAA 4 cut(s) 96, 252, 260, 317
VpaK11BI GGWCC 1 cut(s) 223
XceI RCATGY 1 cut(s) 190
XspI CTAG 2 cut(s) 89, 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.