Rh4DG126700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0001371
Physical Location & Seq
Forward (+)
20732639 .. 20735294
2656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG126700.1

Sequence Viewer

Length: 174 bp
ATGGATTATAAGTTCAGACCATACGATAGAAGTTCCAGGGAACATAGTCCAGATGAAGCAAAGGGAAAGATTCAGGAGACAACTATTCATTTGCGGATTGAAAATCAGGGAGATAAAATGAACTGTGAAAATGGCGCAACTGAAGGCACATATCTCGCAGAAAAGGTTTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.59

Weight (kDa)

5.58

Isoelectric Point (pI)

46.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 9
AciI CCGC 1 cut(s) 94
AcuI CTGAAG 1 cut(s) 162
AgsI TTSAA 1 cut(s) 101
AjnI CCWGG 1 cut(s) 35
AloI GAACNNNNNNTCC 1 cut(s) 28
Alw26I GTCTC 1 cut(s) 71
AspLEI GCGC 1 cut(s) 137
BcgI CGANNNNNNTGC 2 cut(s) 136, 170
BciT130I CCWGG 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 71
Bme1390I CCNGG 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 71
BspACI CCGC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 125
BstHHI GCGC 1 cut(s) 137
BstMAI GTCTC 1 cut(s) 71
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
CfoI GCGC 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 35
FaiI YATR 4 cut(s) 9, 22, 45, 151
GlaI GCGC 1 cut(s) 136
HhaI GCGC 1 cut(s) 137
Hin6I GCGC 1 cut(s) 135
HinP1I GCGC 1 cut(s) 135
HinfI GANTC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 2 cut(s) 50, 74
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 125
HspAI GCGC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 22, 49, 59, 63, 92
MspR9I CCNGG 1 cut(s) 37
MvaI CCWGG 1 cut(s) 37
PfeI GAWTC 1 cut(s) 70
PsiI TTATAA 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 35
PspGI CCWGG 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 37
SetI ASST 1 cut(s) 168
SgeI CNNG 6 cut(s) 48, 49, 62, 86, 119, 167
SsiI CCGC 1 cut(s) 94
StyD4I CCNGG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 125
TfiI GAWTC 1 cut(s) 70
TspDTI ATGAA 3 cut(s) 69, 77, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.