RLG00000022495

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0002265
Physical Location & Seq
Forward (+)
1988439 .. 1989820
1382 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022495

Sequence Viewer

Length: 363 bp
ATGGAGGAACAACTTACCCAGTTGCAAACGAAGGAAGCGCTCCGTGAAGCCCGCAAGCTTAAGCGGAAGGAAAATGAGAGGGAACTAGTCGATAATTCAAGCGATGAAGAACTAGAAGAAGAGGTCATCAAGAAATCGACCCGTGGCAATGTCAAAATTTCAACAAGTGGAAGCTTAGGACCTGACCAAGGCCACGACCAGAAGAAAACCAAAAACGCCAGAGATGAGGGATGGCGGTCACAGATAGAGAAGATGCTAAGAGAGGGTCTCTCAATACTTCTGCAACAAGACGCGCAGGAAAGACATGGCAGGGCTATTCATGGTGAAGTAGAAAGTGGGGGAAAGGCTCAAGATATTCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.66

Weight (kDa)

5.71

Isoelectric Point (pI)

52.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 293
AciI CCGC 3 cut(s) 52, 64, 235
AcsI RAATTY 1 cut(s) 156
AfeI AGCGCT 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 188
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 99, 162
AhlI ACTAGT 1 cut(s) 85
AluBI AGCT 2 cut(s) 58, 174
AluI AGCT 2 cut(s) 58, 174
Alw26I GTCTC 1 cut(s) 272
Aor51HI AGCGCT 1 cut(s) 39
AoxI GGCC 1 cut(s) 190
ApoI RAATTY 1 cut(s) 156
AspLEI GCGC 2 cut(s) 40, 295
AspS9I GGNCC 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 335
AvaII GGWCC 1 cut(s) 179
BccI CCATC 1 cut(s) 225
BcoDI GTCTC 1 cut(s) 272
BcuI ACTAGT 1 cut(s) 85
BfaI CTAG 2 cut(s) 86, 113
BfoI RGCGCY 1 cut(s) 41
BfrI CTTAAG 1 cut(s) 59
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 179
BmrI ACTGGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 243
BmuI ACTGGG 1 cut(s) 13
BplI GAGNNNNNCTC 4 cut(s) 252, 284, 254, 286
Bpu10I CCTNAGC 1 cut(s) 175
BpuEI CTTGAG 1 cut(s) 333
BsaI GGTCTC 1 cut(s) 272
BsaJI CCNNGG 2 cut(s) 142, 187
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 19
Bse3DI GCAATG 1 cut(s) 154
BseDI CCNNGG 2 cut(s) 142, 187
BseGI GGATG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMI GCAATG 1 cut(s) 154
BseNI ACTGG 1 cut(s) 19
Bsh1236I CGCG 1 cut(s) 293
BshFI GGCC 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 272
BsnI GGCC 1 cut(s) 192
Bso31I GGTCTC 1 cut(s) 272
BspACI CCGC 3 cut(s) 52, 64, 235
BspANI GGCC 1 cut(s) 192
BspFNI CGCG 1 cut(s) 293
BspTI CTTAAG 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 272
BsrDI GCAATG 1 cut(s) 154
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 2 cut(s) 142, 187
BssT1I CCWWGG 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 114
BstAFI CTTAAG 1 cut(s) 59
BstC8I GCNNGC 2 cut(s) 52, 56
BstDEI CTNAG 2 cut(s) 175, 257
BstDSI CCRYGG 1 cut(s) 142
BstENI CCTNNNNNAGG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 236
BstFNI CGCG 1 cut(s) 293
BstH2I RGCGCY 1 cut(s) 41
BstHHI GCGC 2 cut(s) 40, 295
BstMAI GTCTC 1 cut(s) 272
BstUI CGCG 1 cut(s) 293
BsuRI GGCC 1 cut(s) 192
BtgI CCRYGG 1 cut(s) 142
BtgZI GCGATG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 236
Cac8I GCNNGC 2 cut(s) 52, 56
CfoI GCGC 2 cut(s) 40, 295
Cfr13I GGNCC 1 cut(s) 179
CseI GACGC 1 cut(s) 299
CviAII CATG 2 cut(s) 305, 320
CviJI RGCY 6 cut(s) 50, 58, 174, 192, 314, 347
CviKI_1 RGCY 6 cut(s) 50, 58, 174, 192, 314, 347
DdeI CTNAG 2 cut(s) 175, 257
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 187
Eco31I GGTCTC 1 cut(s) 272
Eco47I GGWCC 1 cut(s) 179
Eco47III AGCGCT 1 cut(s) 39
EcoNI CCTNNNNNAGG 1 cut(s) 186
EcoO109I RGGNCCY 1 cut(s) 179
EcoT14I CCWWGG 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 187
FaeI CATG 2 cut(s) 308, 323
FaiI YATR 3 cut(s) 306, 321, 361
FatI CATG 2 cut(s) 304, 319
FauI CCCGC 1 cut(s) 59
FokI GGATG 1 cut(s) 243
FspBI CTAG 2 cut(s) 86, 113
GlaI GCGC 2 cut(s) 39, 294
HaeII RGCGCY 1 cut(s) 41
HaeIII GGCC 1 cut(s) 192
HgaI GACGC 1 cut(s) 299
HhaI GCGC 2 cut(s) 40, 295
Hin1II CATG 2 cut(s) 308, 323
Hin6I GCGC 2 cut(s) 38, 293
HinP1I GCGC 2 cut(s) 38, 293
HindIII AAGCTT 2 cut(s) 56, 172
HphI GGTGA 1 cut(s) 335
Hpy188III TCNNGA 2 cut(s) 130, 350
HpyAV CCTTC 2 cut(s) 25, 61
HpyCH4V TGCA 2 cut(s) 25, 283
HpyF3I CTNAG 2 cut(s) 175, 257
Hsp92II CATG 2 cut(s) 308, 323
HspAI GCGC 2 cut(s) 38, 293
LmnI GCTCC 1 cut(s) 45
LpnPI CCDG 6 cut(s) 32, 195, 212, 232, 281, 295
LweI GCATC 1 cut(s) 243
MaeI CTAG 2 cut(s) 86, 113
MaeIII GTNAC 1 cut(s) 237
MboII GAAGA 5 cut(s) 119, 128, 131, 214, 262
MluCI AATT 2 cut(s) 94, 156
MnlI CCTC 4 cut(s) 72, 115, 220, 256
MseI TTAA 1 cut(s) 60
MspCI CTTAAG 1 cut(s) 59
MvnI CGCG 1 cut(s) 293
NlaIII CATG 2 cut(s) 308, 323
NmuCI GTSAC 1 cut(s) 237
PpuMI RGGWCCY 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 179
PspPI GGNCC 1 cut(s) 179
PspPPI RGGWCCY 1 cut(s) 179
SaqAI TTAA 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 179
SetI ASST 4 cut(s) 60, 126, 176, 184
SfaNI GCATC 1 cut(s) 243
SinI GGWCC 1 cut(s) 179
SmlI CTYRAG 2 cut(s) 59, 348
SmoI CTYRAG 2 cut(s) 59, 348
SpeI ACTAGT 1 cut(s) 85
Sse9I AATT 2 cut(s) 94, 156
SsiI CCGC 3 cut(s) 52, 64, 235
SspMI CTAG 2 cut(s) 86, 113
StyI CCWWGG 1 cut(s) 187
TaqI TCGA 2 cut(s) 90, 137
TasI AATT 2 cut(s) 94, 156
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TseFI GTSAC 1 cut(s) 237
Tsp45I GTSAC 1 cut(s) 237
TspDTI ATGAA 2 cut(s) 120, 308
TspGWI ACGGA 1 cut(s) 32
Vha464I CTTAAG 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 179
XagI CCTNNNNNAGG 1 cut(s) 186
XapI RAATTY 1 cut(s) 156
XspI CTAG 2 cut(s) 86, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.