Rroxscaffold_4G00295510

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0002265
Physical Location & Seq
Reverse (-)
15539165 .. 15539401
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00295510.1

Sequence Viewer

Length: 237 bp
ATGGGAAAGGAACTCGCTCAACTGCGAAAGAAAGAAGAACCTAGAGAGACCCGCAAACAGGTGCGCAAGGAGAGTGAGCTAGACCAGATTGAAGATTCAAGTGAAGAGGAAGTAGAGGAAGTGGTAGTCAAGAGGTCATCTCGTGGAGATGCTGAAAATTCAGCAGGAGGAAGCTCAAAATCTATCTCAAGTAACTACCAGAAGAAAACCAAAACAGCAAAAGATGAGAACTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.9

Weight (kDa)

5.6

Isoelectric Point (pI)

70.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 65
AciI CCGC 1 cut(s) 52
AcsI RAATTY 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 58
AgsI TTSAA 2 cut(s) 92, 99
AluBI AGCT 2 cut(s) 79, 174
AluI AGCT 2 cut(s) 79, 174
Alw26I GTCTC 1 cut(s) 41
ApoI RAATTY 1 cut(s) 157
AspLEI GCGC 1 cut(s) 66
BauI CACGAG 1 cut(s) 141
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 2 cut(s) 42, 80
BmsI GCATC 1 cut(s) 139
BplI GAGNNNNNCTC 2 cut(s) 124, 156
BpuEI CTTGAG 1 cut(s) 172
BsaI GGTCTC 1 cut(s) 41
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 236
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 41
Bso31I GGTCTC 1 cut(s) 41
BspACI CCGC 1 cut(s) 52
BspTNI GGTCTC 1 cut(s) 41
BsrI ACTGG 1 cut(s) 236
BssSI CACGAG 1 cut(s) 141
Bst2BI CACGAG 1 cut(s) 141
Bst6I CTCTTC 1 cut(s) 99
BstHHI GCGC 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 41
CfoI GCGC 1 cut(s) 66
CviJI RGCY 2 cut(s) 79, 174
CviKI_1 RGCY 2 cut(s) 79, 174
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco31I GGTCTC 1 cut(s) 41
FauI CCCGC 1 cut(s) 59
FspBI CTAG 2 cut(s) 42, 80
FspI TGCGCA 1 cut(s) 65
GlaI GCGC 1 cut(s) 65
HhaI GCGC 1 cut(s) 66
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HinfI GANTC 1 cut(s) 95
Hpy188III TCNNGA 1 cut(s) 130
HspAI GCGC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 44, 98, 150, 212, 217
LweI GCATC 1 cut(s) 139
MaeI CTAG 2 cut(s) 42, 80
MaeIII GTNAC 1 cut(s) 191
MboII GAAGA 4 cut(s) 47, 104, 116, 214
MluCI AATT 1 cut(s) 157
MnlI CCTC 4 cut(s) 100, 109, 126, 161
NsbI TGCGCA 1 cut(s) 65
PfeI GAWTC 1 cut(s) 95
SetI ASST 5 cut(s) 43, 63, 81, 137, 176
SfaNI GCATC 1 cut(s) 139
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
Sse9I AATT 1 cut(s) 157
SsiI CCGC 1 cut(s) 52
SspMI CTAG 2 cut(s) 42, 80
TasI AATT 1 cut(s) 157
TfiI GAWTC 1 cut(s) 95
XapI RAATTY 1 cut(s) 157
XspI CTAG 2 cut(s) 42, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.