RLG00000033140

protein desumoylation

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
23729077 .. 23729451
375 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033140

Sequence Viewer

Length: 375 bp
ATGCAGGATAGTAATATATCTCTGATATTAATATCAGATTCTATGTCAACGGGCGACGCCATTGATCTAGTGAAGAAGAACGAAATACAAGATGAAGAAGTGTGTACGTTTATGTTAATGCCAACGCAATTCGTTGAAACCACTCGGGGTTTGACAATGGACCAAGCAAATGCCGTCTCCACTATCGGCTTTAGAGAGTTACATCGCTTGGGATGCACCACAATATATGACACGATATGTGAGATGATGGTTAATAGTATTGATCCTCTAAACGAGATTGTGTTGATACATGGCAAGGAAGTACCCTTTGGACCTAAAGATTTTGCACGTGTCATGGGCATAAAGGATGGTGGATTAGACCGATGGGAGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.87

Weight (kDa)

4.42

Isoelectric Point (pI)

43.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 257
AcvI CACGTG 1 cut(s) 329
AcyI GRCGYC 1 cut(s) 57
AfaI GTAC 2 cut(s) 106, 303
AflIII ACRYGT 1 cut(s) 328
AgsI TTSAA 1 cut(s) 137
AjuI GAANNNNNNNTTGG 2 cut(s) 291, 323
Alw26I GTCTC 1 cut(s) 181
AlwI GGATC 1 cut(s) 257
Ama87I CYCGRG 1 cut(s) 144
AseI ATTAAT 1 cut(s) 29
AspS9I GGNCC 2 cut(s) 160, 311
AvaI CYCGRG 1 cut(s) 144
AvaII GGWCC 2 cut(s) 160, 311
BbrPI CACGTG 1 cut(s) 329
BccI CCATC 3 cut(s) 241, 341, 357
BceAI ACGGC 1 cut(s) 158
BcoDI GTCTC 1 cut(s) 181
BfaI CTAG 1 cut(s) 68
Bme18I GGWCC 2 cut(s) 160, 311
BmeT110I CYCGRG 1 cut(s) 144
BmgT120I GGNCC 2 cut(s) 160, 311
BmsI GCATC 1 cut(s) 203
BsaAI YACGTR 1 cut(s) 329
BsaHI GRCGYC 1 cut(s) 57
BseGI GGATG 2 cut(s) 218, 352
BsiHKCI CYCGRG 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 181
BsmBI CGTCTC 1 cut(s) 181
BsoBI CYCGRG 1 cut(s) 144
Bsp143I GATC 2 cut(s) 64, 262
BspPI GGATC 1 cut(s) 257
BssMI GATC 2 cut(s) 64, 262
BssNI GRCGYC 1 cut(s) 57
BstACI GRCGYC 1 cut(s) 57
BstBAI YACGTR 1 cut(s) 329
BstF5I GGATG 2 cut(s) 218, 352
BstKTI GATC 2 cut(s) 67, 265
BstMAI GTCTC 1 cut(s) 181
BstMBI GATC 2 cut(s) 64, 262
BstMWI GCNNNNNNNGC 1 cut(s) 213
BtgZI GCGATG 1 cut(s) 188
BtsCI GGATG 2 cut(s) 218, 352
Cfr13I GGNCC 2 cut(s) 160, 311
CseI GACGC 1 cut(s) 65
Csp6I GTAC 2 cut(s) 105, 302
CviAII CATG 2 cut(s) 290, 334
CviJI RGCY 1 cut(s) 189
CviKI_1 RGCY 1 cut(s) 189
CviQI GTAC 2 cut(s) 105, 302
DpnI GATC 2 cut(s) 66, 264
DpnII GATC 2 cut(s) 64, 262
Eco47I GGWCC 2 cut(s) 160, 311
Eco72I CACGTG 1 cut(s) 329
Eco88I CYCGRG 1 cut(s) 144
Esp3I CGTCTC 1 cut(s) 181
FaeI CATG 2 cut(s) 293, 337
FatI CATG 2 cut(s) 289, 333
FokI GGATG 2 cut(s) 225, 359
FspBI CTAG 1 cut(s) 68
HgaI GACGC 1 cut(s) 65
Hin1I GRCGYC 1 cut(s) 57
Hin1II CATG 2 cut(s) 293, 337
HincII GTYRAC 1 cut(s) 48
HindII GTYRAC 1 cut(s) 48
HinfI GANTC 1 cut(s) 38
Hpy166II GTNNAC 2 cut(s) 48, 105
Hpy188I TCNGA 2 cut(s) 24, 37
Hpy8I GTNNAC 2 cut(s) 48, 105
Hpy99I CGWCG 1 cut(s) 59
HpyCH4IV ACGT 2 cut(s) 107, 328
HpyCH4V TGCA 3 cut(s) 4, 216, 326
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
HpySE526I ACGT 2 cut(s) 107, 328
Hsp92I GRCGYC 1 cut(s) 57
Hsp92II CATG 2 cut(s) 293, 337
Kzo9I GATC 2 cut(s) 64, 262
LweI GCATC 1 cut(s) 203
MaeI CTAG 1 cut(s) 68
MaeII ACGT 2 cut(s) 107, 328
MaeIII GTNAC 1 cut(s) 198
MalI GATC 2 cut(s) 66, 264
MboI GATC 2 cut(s) 64, 262
MboII GAAGA 3 cut(s) 85, 88, 107
MluCI AATT 1 cut(s) 128
MnlI CCTC 1 cut(s) 276
MseI TTAA 3 cut(s) 29, 116, 252
MwoI GCNNNNNNNGC 1 cut(s) 213
NdeII GATC 2 cut(s) 64, 262
NlaIII CATG 2 cut(s) 293, 337
PfeI GAWTC 1 cut(s) 38
PmaCI CACGTG 1 cut(s) 329
PmlI CACGTG 1 cut(s) 329
Ppu21I YACGTR 1 cut(s) 329
PshBI ATTAAT 1 cut(s) 29
PspCI CACGTG 1 cut(s) 329
PspPI GGNCC 2 cut(s) 160, 311
RsaI GTAC 2 cut(s) 106, 303
RsaNI GTAC 2 cut(s) 105, 302
SaqAI TTAA 3 cut(s) 29, 116, 252
Sau3AI GATC 2 cut(s) 64, 262
Sau96I GGNCC 2 cut(s) 160, 311
SetI ASST 3 cut(s) 110, 316, 331
SfaNI GCATC 1 cut(s) 203
SinI GGWCC 2 cut(s) 160, 311
Sse9I AATT 1 cut(s) 128
SspMI CTAG 1 cut(s) 68
TaiI ACGT 2 cut(s) 110, 331
TaqII GACCGA 1 cut(s) 375
TasI AATT 1 cut(s) 128
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 3 cut(s) 29, 116, 252
Tru9I TTAA 3 cut(s) 29, 116, 252
TspDTI ATGAA 1 cut(s) 108
VpaK11BI GGWCC 2 cut(s) 160, 311
VspI ATTAAT 1 cut(s) 29
XspI CTAG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.