Rh6CG173400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
24376018 .. 24376822
805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG173400.1

Sequence Viewer

Length: 306 bp
ATGGGCCAACACAGCGATGGGCTCGATGATGGTACTAGTCTAAACCCCCTTAATGAGAGAGCCAACATACATGGCAAGGAATTCGATGCAAGACTGATTGATTTCTCCCGCATAATGGAGATACGTGATGGAGGTGAAGATGTGAAGTTAAGTGGTTCAATTAATGATGTAAGGGTGCTAAGTTTACGGAAGTATTTGGCACTCGGTCACCGGGAAGTCCACATTCACCATGTGAAGAATTTGATGCTGGAAACAAACATCCCGGATGACACTTTCAAGGTGGCATATGCACTATATTTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.46

Weight (kDa)

5.8

Isoelectric Point (pI)

26.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 109
AcsI RAATTY 2 cut(s) 80, 238
AdeI CACNNNGTG 1 cut(s) 232
AfaI GTAC 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 2 cut(s) 159, 277
AhlI ACTAGT 1 cut(s) 35
AoxI GGCC 1 cut(s) 4
ApoI RAATTY 2 cut(s) 80, 238
AseI ATTAAT 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 2 cut(s) 212, 263
AsuHPI GGTGA 3 cut(s) 146, 200, 218
BanII GRGCYC 1 cut(s) 24
BccI CCATC 3 cut(s) 11, 23, 122
BcgI CGANNNNNNTGC 2 cut(s) 64, 98
BcnI CCSGG 2 cut(s) 212, 263
BcuI ACTAGT 1 cut(s) 35
BfaI CTAG 1 cut(s) 36
Bme1390I CCNGG 2 cut(s) 212, 263
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 2 cut(s) 212, 263
BmsI GCATC 2 cut(s) 76, 234
BpuMI CCSGG 2 cut(s) 212, 263
BsaAI YACGTR 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseGI GGATG 2 cut(s) 258, 271
BseLI CCNNNNNNNGG 1 cut(s) 115
BshFI GGCC 1 cut(s) 6
BsiSI CCGG 2 cut(s) 211, 263
BslI CCNNNNNNNGG 1 cut(s) 115
BsnI GGCC 1 cut(s) 6
Bsp1286I GDGCHC 1 cut(s) 24
BspACI CCGC 1 cut(s) 109
BspANI GGCC 1 cut(s) 6
BstBAI YACGTR 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 179
BstEII GGTNACC 1 cut(s) 206
BstF5I GGATG 2 cut(s) 258, 271
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstPI GGTNACC 1 cut(s) 206
BstSCI CCNGG 2 cut(s) 210, 261
BsuRI GGCC 1 cut(s) 6
BtgZI GCGATG 1 cut(s) 30
BtsCI GGATG 2 cut(s) 258, 271
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 33
CviAII CATG 2 cut(s) 71, 230
CviJI RGCY 3 cut(s) 6, 22, 62
CviKI_1 RGCY 3 cut(s) 6, 22, 62
CviQI GTAC 1 cut(s) 33
DdeI CTNAG 1 cut(s) 179
DraIII CACNNNGTG 1 cut(s) 232
Eco24I GRGCYC 1 cut(s) 24
Eco91I GGTNACC 1 cut(s) 206
EcoO65I GGTNACC 1 cut(s) 206
EcoRI GAATTC 1 cut(s) 80
EcoT38I GRGCYC 1 cut(s) 24
FaeI CATG 2 cut(s) 74, 233
FaiI YATR 7 cut(s) 68, 72, 113, 231, 286, 288, 295
FatI CATG 2 cut(s) 70, 229
FauI CCCGC 1 cut(s) 116
FauNDI CATATG 1 cut(s) 286
FokI GGATG 2 cut(s) 245, 278
FriOI GRGCYC 1 cut(s) 24
FspBI CTAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 6
HapII CCGG 2 cut(s) 211, 263
Hin1II CATG 2 cut(s) 74, 233
HpaII CCGG 2 cut(s) 211, 263
HphI GGTGA 3 cut(s) 146, 200, 218
Hpy166II GTNNAC 2 cut(s) 185, 220
Hpy8I GTNNAC 2 cut(s) 185, 220
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 2 cut(s) 89, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 179
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 2 cut(s) 74, 233
LpnPI CCDG 3 cut(s) 224, 233, 276
LweI GCATC 2 cut(s) 76, 234
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 124
MaeIII GTNAC 1 cut(s) 206
MboII GAAGA 2 cut(s) 149, 247
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 3 cut(s) 80, 159, 238
MnlI CCTC 1 cut(s) 125
MseI TTAA 3 cut(s) 51, 149, 162
MslI CAYNNNNRTG 1 cut(s) 15
MspI CCGG 2 cut(s) 211, 263
MspR9I CCNGG 2 cut(s) 212, 263
MwoI GCNNNNNNNGC 1 cut(s) 12
NciI CCSGG 2 cut(s) 212, 263
NdeI CATATG 1 cut(s) 286
NlaIII CATG 2 cut(s) 74, 233
NmuCI GTSAC 1 cut(s) 206
PfoI TCCNGGA 1 cut(s) 261
Ppu21I YACGTR 1 cut(s) 125
PshBI ATTAAT 1 cut(s) 162
PspEI GGTNACC 1 cut(s) 206
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 3 cut(s) 51, 149, 162
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 2 cut(s) 212, 263
SduI GDGCHC 1 cut(s) 24
SetI ASST 3 cut(s) 127, 136, 282
SfaNI GCATC 2 cut(s) 76, 234
SmiMI CAYNNNNRTG 1 cut(s) 15
SpeI ACTAGT 1 cut(s) 35
Sse9I AATT 3 cut(s) 80, 159, 238
SsiI CCGC 1 cut(s) 109
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 2 cut(s) 210, 261
TaiI ACGT 1 cut(s) 127
TaqI TCGA 2 cut(s) 24, 84
TaqII GACCGA 1 cut(s) 194
TasI AATT 3 cut(s) 80, 159, 238
Tru1I TTAA 3 cut(s) 51, 149, 162
Tru9I TTAA 3 cut(s) 51, 149, 162
TseFI GTSAC 1 cut(s) 206
Tsp45I GTSAC 1 cut(s) 206
TspGWI ACGGA 1 cut(s) 202
VspI ATTAAT 1 cut(s) 162
XapI RAATTY 2 cut(s) 80, 238
XcmI CCANNNNNNNNNTGG 1 cut(s) 14
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.