Rmu_sc0008769.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008769.1
OG0002409
Physical Location & Seq
Forward (+)
38982 .. 41993
3012 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008769.1_g000009.1.cds

Sequence Viewer

Length: 729 bp
atggaccaagcaaatgccatctccactatcggctttagcgagttacatagcctgggatgcaccacaatatatgacacggtatgtgagatgatgattaatagtattgattctctaaacgagattgtgttgatacatggcaaggaagtgccttttagacccaaagactttgcacatgtcatggacataaaggatgatggattagacattcagattatgggagatacgaatgaaaaacagcgagatgaaggcaagcatggggagtgccaagatcaattaaagttcagagccaaccttaatgtgcatgaattcagaggctcagaggcacattctaatgatccatcaagattattgaaggggaaaaatatttgcatgacccccctgccagacgagatatacattcctctgcgcgatcctgcatttgagaggcattggtatttgttggtggtgcacaaagattccagatttggggaaatcattgacagtgcacctgatgatgataggacttcattccgtgaggaagctgcaagaatggcgatgaagatgctagacaatattttttctgatgatattagggaggaaatgggagtgctatctcattttgctgatcttccattcatggttaagcgtaaccacctggttcaaagaaacatgttcgactgtagtgtgtttgtaataagaaacatgcagcattatggcacacaatggaatggggatgtgagtggcctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMG_box

Protein Analysis

242

Amino Acids

27.82

Weight (kDa)

5.08

Isoelectric Point (pI)

37.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 408
AclWI GGATC 2 cut(s) 329, 404
AcsI RAATTY 1 cut(s) 305
AfiI CCNNNNNNNGG 1 cut(s) 465
AflIII ACRYGT 2 cut(s) 172, 648
AgsI TTSAA 2 cut(s) 352, 641
AjnI CCWGG 2 cut(s) 51, 633
AluBI AGCT 1 cut(s) 521
AluI AGCT 1 cut(s) 521
Alw21I GWGCWC 2 cut(s) 450, 487
Alw44I GTGCAC 2 cut(s) 446, 483
AlwI GGATC 2 cut(s) 329, 404
AoxI GGCC 1 cut(s) 721
ApaLI GTGCAC 2 cut(s) 446, 483
ApeKI GCWGC 2 cut(s) 521, 685
ApoI RAATTY 1 cut(s) 305
AseI ATTAAT 1 cut(s) 96
AspLEI GCGC 1 cut(s) 408
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BaeGI GKGCMC 2 cut(s) 450, 487
Bbv12I GWGCWC 2 cut(s) 450, 487
BbvI GCAGC 2 cut(s) 508, 697
BccI CCATC 3 cut(s) 26, 188, 346
BcgI CGANNNNNNTGC 2 cut(s) 523, 557
BciT130I CCWGG 2 cut(s) 53, 635
BfaI CTAG 1 cut(s) 545
BfmI CTRYAG 1 cut(s) 658
BisI GCNGC 2 cut(s) 522, 686
BlsI GCNGC 2 cut(s) 523, 687
Bme1390I CCNGG 2 cut(s) 53, 635
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 2 cut(s) 53, 635
BmsI GCATC 2 cut(s) 47, 531
BsaJI CCNNGG 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 465
BseBI CCWGG 2 cut(s) 53, 635
BseDI CCNNGG 1 cut(s) 52
BseGI GGATG 3 cut(s) 62, 196, 718
BseLI CCNNNNNNNGG 1 cut(s) 465
BseMII CTCAG 1 cut(s) 330
BseSI GKGCMC 2 cut(s) 450, 487
BseXI GCAGC 2 cut(s) 508, 697
Bsh1236I CGCG 1 cut(s) 408
BshFI GGCC 1 cut(s) 723
BsiHKAI GWGCWC 2 cut(s) 450, 487
BslI CCNNNNNNNGG 1 cut(s) 465
BsnI GGCC 1 cut(s) 723
Bsp1286I GDGCHC 2 cut(s) 450, 487
Bsp143I GATC 4 cut(s) 268, 334, 409, 604
BspANI GGCC 1 cut(s) 723
BspCNI CTCAG 1 cut(s) 329
BspFNI CGCG 1 cut(s) 408
BspPI GGATC 2 cut(s) 329, 404
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 4 cut(s) 268, 334, 409, 604
Bst2UI CCWGG 2 cut(s) 53, 635
Bst4CI ACNGT 3 cut(s) 79, 482, 659
BstC8I GCNNGC 1 cut(s) 251
BstDEI CTNAG 1 cut(s) 316
BstF5I GGATG 3 cut(s) 62, 196, 718
BstFNI CGCG 1 cut(s) 408
BstHHI GCGC 1 cut(s) 408
BstKTI GATC 4 cut(s) 271, 337, 412, 607
BstMBI GATC 4 cut(s) 268, 334, 409, 604
BstMWI GCNNNNNNNGC 2 cut(s) 57, 530
BstNI CCWGG 2 cut(s) 53, 635
BstNSI RCATGY 3 cut(s) 176, 652, 685
BstSCI CCNGG 2 cut(s) 51, 633
BstSFI CTRYAG 1 cut(s) 658
BstSLI GKGCMC 2 cut(s) 450, 487
BstUI CGCG 1 cut(s) 408
BstV1I GCAGC 2 cut(s) 508, 697
BsuRI GGCC 1 cut(s) 723
BtgZI GCGATG 1 cut(s) 548
BtsCI GGATG 3 cut(s) 62, 196, 718
BtsIMutI CAGTG 1 cut(s) 487
Cac8I GCNNGC 1 cut(s) 251
CfoI GCGC 1 cut(s) 408
Cfr13I GGNCC 1 cut(s) 4
CsiI ACCWGGT 1 cut(s) 633
CviAII CATG 9 cut(s) 134, 173, 178, 254, 302, 370, 616, 649, 682
CviJI RGCY 6 cut(s) 33, 51, 287, 315, 521, 723
CviKI_1 RGCY 6 cut(s) 33, 51, 287, 315, 521, 723
DdeI CTNAG 1 cut(s) 316
DpnI GATC 4 cut(s) 270, 336, 411, 606
DpnII GATC 4 cut(s) 268, 334, 409, 604
Eco47I GGWCC 1 cut(s) 4
EcoRI GAATTC 1 cut(s) 305
EcoRII CCWGG 2 cut(s) 51, 633
FaeI CATG 9 cut(s) 137, 176, 181, 257, 305, 373, 619, 652, 685
FatI CATG 9 cut(s) 133, 172, 177, 253, 301, 369, 615, 648, 681
Fnu4HI GCNGC 2 cut(s) 522, 686
FokI GGATG 3 cut(s) 69, 203, 725
Fsp4HI GCNGC 2 cut(s) 522, 686
FspBI CTAG 1 cut(s) 545
GlaI GCGC 1 cut(s) 407
GluI GCNGC 2 cut(s) 522, 686
HaeIII GGCC 1 cut(s) 723
HhaI GCGC 1 cut(s) 408
Hin1II CATG 9 cut(s) 137, 176, 181, 257, 305, 373, 619, 652, 685
Hin6I GCGC 1 cut(s) 406
HinP1I GCGC 1 cut(s) 406
HinfI GANTC 2 cut(s) 107, 455
Hpy166II GTNNAC 2 cut(s) 448, 485
Hpy188I TCNGA 5 cut(s) 210, 284, 311, 319, 562
Hpy188III TCNNGA 2 cut(s) 342, 459
Hpy8I GTNNAC 2 cut(s) 448, 485
HpyAV CCTTC 2 cut(s) 239, 346
HpyCH4III ACNGT 3 cut(s) 79, 482, 659
HpyCH4V TGCA 9 cut(s) 60, 170, 301, 369, 416, 448, 485, 524, 685
HpyF10VI GCNNNNNNNGC 2 cut(s) 57, 530
HpyF3I CTNAG 1 cut(s) 316
Hsp92II CATG 9 cut(s) 137, 176, 181, 257, 305, 373, 619, 652, 685
HspAI GCGC 1 cut(s) 406
Kzo9I GATC 4 cut(s) 268, 334, 409, 604
LpnPI CCDG 9 cut(s) 38, 65, 392, 396, 426, 472, 501, 620, 647
Lsp1109I GCAGC 2 cut(s) 508, 697
LweI GCATC 2 cut(s) 47, 531
MabI ACCWGGT 1 cut(s) 633
MaeI CTAG 1 cut(s) 545
MaeIII GTNAC 2 cut(s) 42, 626
MalI GATC 4 cut(s) 270, 336, 411, 606
MboI GATC 4 cut(s) 268, 334, 409, 604
MboII GAAGA 2 cut(s) 550, 599
MhlI GDGCHC 2 cut(s) 450, 487
MluCI AATT 2 cut(s) 272, 305
MnlI CCTC 6 cut(s) 305, 313, 411, 417, 508, 568
MseI TTAA 4 cut(s) 96, 275, 294, 621
MslI CAYNNNNRTG 1 cut(s) 330
MspR9I CCNGG 2 cut(s) 53, 635
MvaI CCWGG 2 cut(s) 53, 635
MvnI CGCG 1 cut(s) 408
MwoI GCNNNNNNNGC 2 cut(s) 57, 530
NdeII GATC 4 cut(s) 268, 334, 409, 604
NlaIII CATG 9 cut(s) 137, 176, 181, 257, 305, 373, 619, 652, 685
NspI RCATGY 3 cut(s) 176, 652, 685
PciI ACATGT 2 cut(s) 172, 648
PcsI WCGNNNNNNNCGW 1 cut(s) 36
PfeI GAWTC 2 cut(s) 107, 455
PkrI GCNGC 2 cut(s) 523, 687
PscI ACATGT 2 cut(s) 172, 648
PshBI ATTAAT 1 cut(s) 96
Psp6I CCWGG 2 cut(s) 51, 633
PspGI CCWGG 2 cut(s) 51, 633
PspPI GGNCC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 330
SaqAI TTAA 4 cut(s) 96, 275, 294, 621
SatI GCNGC 2 cut(s) 522, 686
Sau3AI GATC 4 cut(s) 268, 334, 409, 604
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 2 cut(s) 53, 635
SduI GDGCHC 2 cut(s) 450, 487
SetI ASST 4 cut(s) 294, 490, 523, 636
SexAI ACCWGGT 1 cut(s) 633
SfaNI GCATC 2 cut(s) 47, 531
SfcI CTRYAG 1 cut(s) 658
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 330
Sse9I AATT 2 cut(s) 272, 305
SspI AATATT 2 cut(s) 364, 553
SspMI CTAG 1 cut(s) 545
StyD4I CCNGG 2 cut(s) 51, 633
TaaI ACNGT 3 cut(s) 79, 482, 659
TaqI TCGA 1 cut(s) 654
TasI AATT 2 cut(s) 272, 305
TfiI GAWTC 2 cut(s) 107, 455
Tru1I TTAA 4 cut(s) 96, 275, 294, 621
Tru9I TTAA 4 cut(s) 96, 275, 294, 621
TscAI CASTG 1 cut(s) 487
TseI GCWGC 2 cut(s) 521, 685
TspDTI ATGAA 6 cut(s) 243, 258, 318, 495, 551, 604
TspGWI ACGGA 1 cut(s) 500
TspRI CASTG 1 cut(s) 487
VneI GTGCAC 2 cut(s) 446, 483
VpaK11BI GGWCC 1 cut(s) 4
VspI ATTAAT 1 cut(s) 96
XapI RAATTY 1 cut(s) 305
XceI RCATGY 3 cut(s) 176, 652, 685
XspI CTAG 1 cut(s) 545
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.