Rroxscaffold_2G00118170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002409
Physical Location & Seq
Reverse (-)
49352856 .. 49353477
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00118170.1

Sequence Viewer

Length: 468 bp
ATGGAACAAAAAGAAAGTCGACTGACAGAATCAATGGAAAGAATGGAGCGGATGCTAGGCTCATTCCAAGGGGCAACAATTAAACATATCGTTGGAGAGGTGTTGGCTCGTTTAGAACAGCGAGATGAAGGCAAGCATGGGGAGTGCCAAGATCAATTTAAGTTCAGAGCGGACCTTAATATGCATGAATTCAGAGGCTCAGAGGCACAGTCTAATGATCCATCAAGACTATTGAAGGGCAAAAATATTTGCATGAAGCCAGACGAGGTTTGCATGGCTAGAAAGATGAATCCCCCGCTCAAAGTCCAATCAAAATGTTCATTTAGCCCAGATGGTCCTCCGAAGCCGGCTAAGCGATCAATAAAGGAAAGAAACCAAGGGCTGTCGGGGTGCAGTCAATGCATATACGGAAGGCTCTTTTCAAAACACGAGGAAGAACATATGGCAAGCAAACAAGAGCGGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

17.77

Weight (kDa)

8.93

Isoelectric Point (pI)

54.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 4 cut(s) 49, 170, 298, 460
AccI GTMKAC 1 cut(s) 19
AciI CCGC 4 cut(s) 49, 170, 296, 460
AclWI GGATC 1 cut(s) 212
AcsI RAATTY 1 cut(s) 188
AgsI TTSAA 2 cut(s) 235, 423
AlwI GGATC 1 cut(s) 212
ApoI RAATTY 1 cut(s) 188
ArsI GACNNNNNNTTYG 1 cut(s) 33
AspS9I GGNCC 2 cut(s) 172, 335
AvaII GGWCC 2 cut(s) 172, 335
BauI CACGAG 1 cut(s) 428
BccI CCATC 2 cut(s) 229, 326
BfaI CTAG 2 cut(s) 56, 279
BlpI GCTNAGC 1 cut(s) 351
Bme18I GGWCC 2 cut(s) 172, 335
BmgT120I GGNCC 2 cut(s) 172, 335
BmsI GCATC 1 cut(s) 42
Bpu1102I GCTNAGC 1 cut(s) 351
BsaJI CCNNGG 2 cut(s) 67, 376
Bse118I RCCGGY 1 cut(s) 346
BseDI CCNNGG 2 cut(s) 67, 376
BseGI GGATG 1 cut(s) 57
BseMII CTCAG 1 cut(s) 213
BsgI GTGCAG 1 cut(s) 412
BsiSI CCGG 1 cut(s) 347
Bsp143I GATC 3 cut(s) 151, 217, 356
Bsp1720I GCTNAGC 1 cut(s) 351
BspACI CCGC 4 cut(s) 49, 170, 296, 460
BspCNI CTCAG 1 cut(s) 212
BspPI GGATC 1 cut(s) 212
BsrBI CCGCTC 4 cut(s) 49, 170, 298, 460
BsrFI RCCGGY 1 cut(s) 346
BssAI RCCGGY 1 cut(s) 346
BssECI CCNNGG 2 cut(s) 67, 376
BssMI GATC 3 cut(s) 151, 217, 356
BssSI CACGAG 1 cut(s) 428
BssT1I CCWWGG 2 cut(s) 67, 376
Bst2BI CACGAG 1 cut(s) 428
Bst4CI ACNGT 1 cut(s) 210
BstAPI GCANNNNNTGC 1 cut(s) 399
BstC8I GCNNGC 3 cut(s) 134, 348, 448
BstDEI CTNAG 2 cut(s) 199, 351
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 3 cut(s) 154, 220, 359
BstMBI GATC 3 cut(s) 151, 217, 356
BstMWI GCNNNNNNNGC 2 cut(s) 352, 399
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 3 cut(s) 134, 348, 448
Cfr10I RCCGGY 1 cut(s) 346
Cfr13I GGNCC 2 cut(s) 172, 335
CviAII CATG 4 cut(s) 137, 185, 253, 274
DdeI CTNAG 2 cut(s) 199, 351
DpnI GATC 3 cut(s) 153, 219, 358
DpnII GATC 3 cut(s) 151, 217, 356
Eco130I CCWWGG 2 cut(s) 67, 376
Eco47I GGWCC 2 cut(s) 172, 335
EcoRI GAATTC 1 cut(s) 188
EcoT14I CCWWGG 2 cut(s) 67, 376
EcoT22I ATGCAT 2 cut(s) 186, 404
ErhI CCWWGG 2 cut(s) 67, 376
FaeI CATG 4 cut(s) 140, 188, 256, 277
FatI CATG 4 cut(s) 136, 184, 252, 273
FauI CCCGC 1 cut(s) 303
FauNDI CATATG 1 cut(s) 441
FblI GTMKAC 1 cut(s) 19
FokI GGATG 1 cut(s) 64
FspBI CTAG 2 cut(s) 56, 279
HapII CCGG 1 cut(s) 347
Hin1II CATG 4 cut(s) 140, 188, 256, 277
HincII GTYRAC 1 cut(s) 20
HindII GTYRAC 1 cut(s) 20
HinfI GANTC 2 cut(s) 29, 289
HpaII CCGG 1 cut(s) 347
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 4 cut(s) 167, 194, 202, 342
Hpy188III TCNNGA 1 cut(s) 225
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 3 cut(s) 122, 229, 405
HpyCH4III ACNGT 1 cut(s) 210
HpyCH4V TGCA 5 cut(s) 184, 252, 273, 393, 402
HpyF10VI GCNNNNNNNGC 2 cut(s) 352, 399
HpyF3I CTNAG 2 cut(s) 199, 351
Hsp92II CATG 4 cut(s) 140, 188, 256, 277
KroI GCCGGC 1 cut(s) 346
KroNI GCCGGC 1 cut(s) 348
Kzo9I GATC 3 cut(s) 151, 217, 356
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 3 cut(s) 273, 342, 360
LweI GCATC 1 cut(s) 42
MaeI CTAG 2 cut(s) 56, 279
MalI GATC 3 cut(s) 153, 219, 358
MbiI CCGCTC 4 cut(s) 49, 170, 298, 460
MboI GATC 3 cut(s) 151, 217, 356
MboII GAAGA 1 cut(s) 446
MluCI AATT 3 cut(s) 78, 155, 188
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 6 cut(s) 91, 188, 196, 259, 348, 424
Mph1103I ATGCAT 2 cut(s) 186, 404
MroNI GCCGGC 1 cut(s) 346
MseI TTAA 3 cut(s) 81, 159, 177
MspI CCGG 1 cut(s) 347
MwoI GCNNNNNNNGC 2 cut(s) 352, 399
NaeI GCCGGC 1 cut(s) 348
NdeI CATATG 1 cut(s) 441
NdeII GATC 3 cut(s) 151, 217, 356
NgoMIV GCCGGC 1 cut(s) 346
NlaIII CATG 4 cut(s) 140, 188, 256, 277
NsiI ATGCAT 2 cut(s) 186, 404
PdiI GCCGGC 1 cut(s) 348
PfeI GAWTC 2 cut(s) 29, 289
PspPI GGNCC 2 cut(s) 172, 335
SalI GTCGAC 1 cut(s) 18
SaqAI TTAA 3 cut(s) 81, 159, 177
Sau3AI GATC 3 cut(s) 151, 217, 356
Sau96I GGNCC 2 cut(s) 172, 335
SetI ASST 3 cut(s) 102, 177, 270
SfaNI GCATC 1 cut(s) 42
SinI GGWCC 2 cut(s) 172, 335
Sse9I AATT 3 cut(s) 78, 155, 188
SsiI CCGC 4 cut(s) 49, 170, 296, 460
SspI AATATT 1 cut(s) 247
SspMI CTAG 2 cut(s) 56, 279
StyI CCWWGG 2 cut(s) 67, 376
TaaI ACNGT 1 cut(s) 210
TaqI TCGA 1 cut(s) 19
TasI AATT 3 cut(s) 78, 155, 188
TfiI GAWTC 2 cut(s) 29, 289
Tru1I TTAA 3 cut(s) 81, 159, 177
Tru9I TTAA 3 cut(s) 81, 159, 177
TspDTI ATGAA 5 cut(s) 141, 201, 269, 302, 309
TspGWI ACGGA 1 cut(s) 423
VpaK11BI GGWCC 2 cut(s) 172, 335
XapI RAATTY 1 cut(s) 188
XmiI GTMKAC 1 cut(s) 19
XspI CTAG 2 cut(s) 56, 279
Zsp2I ATGCAT 2 cut(s) 186, 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.