Rroxscaffold_2G00118160

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002409
Physical Location & Seq
Reverse (-)
49350970 .. 49352662
1693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00118160.1

Sequence Viewer

Length: 396 bp
ATGTTTGCTTTGATTAACAGATATTACAATGTCACAGTAGCTAAACATGGGGGAGTGATTGTATCAAGAGCTGACATGCAATGCCTACTGCCTGGTCAATTTTTGAGCGACTATATATACATTCCTCTGCGTGATCCTGCATCTGAGGGGCATTGGTATTTGTTGGTGGTGCACAAAGACTCCAGATTTGGGGAAATCGTTGACAGTGCACCTGATGATGATAGGACTTCATTCCGTGAGGAAGTTGCAAGAATGACGTATGTTTCAGATGAGCACCGCGCAAATTTGGTCCTTGAGTGTGTCAATCACCCTCGCAATGAGGTGGTAAATGTAAGAGAAATGGTGGCAGATTGTTTGTCGCAACGAGGGGGAGATGCGGGTAGATGGAACGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.96

Weight (kDa)

5.45

Isoelectric Point (pI)

33.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 279
AciI CCGC 2 cut(s) 277, 377
AclWI GGATC 1 cut(s) 128
AcsI RAATTY 1 cut(s) 283
AfiI CCNNNNNNNGG 1 cut(s) 189
AflIII ACRYGT 1 cut(s) 390
AjnI CCWGG 1 cut(s) 91
AluBI AGCT 2 cut(s) 41, 71
AluI AGCT 2 cut(s) 41, 71
Alw21I GWGCWC 3 cut(s) 174, 211, 276
Alw44I GTGCAC 2 cut(s) 170, 207
AlwI GGATC 1 cut(s) 128
ApaLI GTGCAC 2 cut(s) 170, 207
ApoI RAATTY 1 cut(s) 283
ArsI GACNNNNNNTTYG 2 cut(s) 170, 202
AspLEI GCGC 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 289
AsuHPI GGTGA 1 cut(s) 299
AvaII GGWCC 1 cut(s) 289
BaeGI GKGCMC 2 cut(s) 174, 211
Bbv12I GWGCWC 3 cut(s) 174, 211, 276
BccI CCATC 1 cut(s) 378
BciT130I CCWGG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 289
BmgT120I GGNCC 1 cut(s) 289
BmrFI CCNGG 1 cut(s) 93
BmsI GCATC 2 cut(s) 149, 364
BpmI CTGGAG 1 cut(s) 166
BpuEI CTTGAG 1 cut(s) 314
BsaXI ACNNNNNCTCC 4 cut(s) 45, 75, 164, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 189
Bse3DI GCAATG 2 cut(s) 86, 322
BseBI CCWGG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 189
BseMI GCAATG 2 cut(s) 86, 322
BseMII CTCAG 1 cut(s) 135
BseSI GKGCMC 2 cut(s) 174, 211
Bsh1236I CGCG 1 cut(s) 279
BsiHKAI GWGCWC 3 cut(s) 174, 211, 276
BslI CCNNNNNNNGG 1 cut(s) 189
Bsp1286I GDGCHC 3 cut(s) 174, 211, 276
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 2 cut(s) 277, 377
BspCNI CTCAG 1 cut(s) 136
BspFNI CGCG 1 cut(s) 279
BspPI GGATC 1 cut(s) 128
BsrDI GCAATG 2 cut(s) 86, 322
BssMI GATC 1 cut(s) 133
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 2 cut(s) 37, 206
BstDEI CTNAG 1 cut(s) 144
BstFNI CGCG 1 cut(s) 279
BstHHI GCGC 1 cut(s) 281
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 93
BstNSI RCATGY 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 91
BstSLI GKGCMC 2 cut(s) 174, 211
BstUI CGCG 1 cut(s) 279
BtsIMutI CAGTG 1 cut(s) 211
CfoI GCGC 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 289
CviAII CATG 2 cut(s) 47, 76
CviJI RGCY 2 cut(s) 41, 71
CviKI_1 RGCY 2 cut(s) 41, 71
DdeI CTNAG 1 cut(s) 144
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 289
EcoRII CCWGG 1 cut(s) 91
FaeI CATG 2 cut(s) 50, 79
FaiI YATR 6 cut(s) 48, 77, 114, 116, 118, 261
FatI CATG 2 cut(s) 46, 75
FauI CCCGC 1 cut(s) 370
GlaI GCGC 1 cut(s) 280
GsuI CTGGAG 1 cut(s) 166
HhaI GCGC 1 cut(s) 281
Hin1II CATG 2 cut(s) 50, 79
Hin6I GCGC 1 cut(s) 279
HinP1I GCGC 1 cut(s) 279
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 179
HphI GGTGA 1 cut(s) 299
Hpy166II GTNNAC 3 cut(s) 172, 202, 209
Hpy188I TCNGA 2 cut(s) 145, 268
Hpy188III TCNNGA 2 cut(s) 66, 183
Hpy8I GTNNAC 3 cut(s) 172, 202, 209
HpyCH4III ACNGT 2 cut(s) 37, 206
HpyCH4IV ACGT 2 cut(s) 257, 390
HpyCH4V TGCA 5 cut(s) 79, 140, 172, 209, 248
HpyF3I CTNAG 1 cut(s) 144
HpySE526I ACGT 2 cut(s) 257, 390
Hsp92II CATG 2 cut(s) 50, 79
HspAI GCGC 1 cut(s) 279
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 5 cut(s) 78, 105, 150, 196, 225
LweI GCATC 2 cut(s) 149, 364
MaeII ACGT 2 cut(s) 257, 390
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MhlI GDGCHC 3 cut(s) 174, 211, 276
MluCI AATT 2 cut(s) 98, 283
MlyI GAGTC 1 cut(s) 173
MnlI CCTC 6 cut(s) 135, 139, 232, 313, 321, 359
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 93
MvnI CGCG 1 cut(s) 279
NdeII GATC 1 cut(s) 133
NlaIII CATG 2 cut(s) 50, 79
NmuCI GTSAC 1 cut(s) 31
NspI RCATGY 1 cut(s) 79
PleI GAGTC 1 cut(s) 173
PpsI GAGTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PspPI GGNCC 1 cut(s) 289
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 289
SchI GAGTC 1 cut(s) 173
ScrFI CCNGG 1 cut(s) 93
SduI GDGCHC 3 cut(s) 174, 211, 276
SetI ASST 6 cut(s) 43, 73, 214, 260, 324, 393
SfaNI GCATC 2 cut(s) 149, 364
SinI GGWCC 1 cut(s) 289
SmlI CTYRAG 1 cut(s) 293
SmoI CTYRAG 1 cut(s) 293
Sse9I AATT 2 cut(s) 98, 283
SsiI CCGC 2 cut(s) 277, 377
StyD4I CCNGG 1 cut(s) 91
TaaI ACNGT 2 cut(s) 37, 206
TaiI ACGT 2 cut(s) 260, 393
TasI AATT 2 cut(s) 98, 283
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 1 cut(s) 211
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 219
TspGWI ACGGA 1 cut(s) 224
TspRI CASTG 1 cut(s) 211
VneI GTGCAC 2 cut(s) 170, 207
VpaK11BI GGWCC 1 cut(s) 289
XapI RAATTY 1 cut(s) 283
XceI RCATGY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.