Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr7

Orthogroup ID

OG0002409

Physical Location & Seq

Genomic Coordinates Forward (+)

23730087 .. 23730782

Gene Structure 696 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000033141

Sequence Viewer

CDS Protein Promoter (2k)

Length: 555 bp

ATGCTAGGCTCATTCCAAGGGGCAACAATTAAACATATCCTTGGAGAGGTGTTGGCTCGTTTAGAACAGCGAGATGAAGGCAAGCATGGGGAGTGCCAAGATCAATTAAAGTTCAGGGCCGACCTTAATGTGCATGAATTCAGAGGCTCAGAGGCACAGTCTAATGATCCATCAAGACTATTGAAGGATAAAAATATTTGCATGAACCCCCTTCCAGACGAGGTTTGCATGGCTAGAAAGATGAATCCCCAGCTCAAAGTCCAATCAAAATGTTCATTTAGCCCAGATGGTCCTTTGAAGCCGGCTAAGCGATCAATAAAGGAAAAGAAACTAAGGCCTGTCGGGGTGCAGTCAATGCATATACGGAAGGCTCTTTTCAAAACACGAGGAAGAACATATGGCAAGCAAACAAGAGCAGAACTGAAGGATGATGAAAAGCAAGAGGAACAAGGTCTTCGTTGCCTATTCAACGTCAAAGCAAATACTCCAAAGGAGGACATCGAGTTGTTGACTTTCATTGGGTTAGTAAGAAGCCACTTACAAATCTTCAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

185

Amino Acids

21.03

Weight (kDa)

9.57

Isoelectric Point (pI)

57.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002409)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000002091 RLG00000004454 RLG00000033140 RLG00000033141 RLG00000033142
rosa_multiflora	Rmu_sc0000077.1_g000043 Rmu_sc0000361.1_g000004 Rmu_sc0002048.1_g000017 Rmu_sc0007180.1_g000005 Rmu_sc0007223.1_g000007 Rmu_sc0008769.1_g000009
rosa_roxburghii	Rroxscaffold_2G00118160 Rroxscaffold_2G00118170 Rroxscaffold_2G00125280 Rroxscaffold_3G00237010 Rroxscaffold_5G00349960 Rroxscaffold_5G00349970 Rroxscaffold_5G00362900 Rroxscaffold_7G00197790 Rroxscaffold_7G00197870
rosa_rugosa	Rorug07G0208000
rosa_samantha	Rh1BG098800 Rh1CG156600 Rh2DG571500 Rh4AG336300 Rh4BG133300 Rh4BG219500 Rh4DG120500 Rh4DG338800 Rh5DG299800 Rh6AG195900 Rh6BG101300 Rh6BG101400 Rh6BG101500 Rh6CG173400 Rh6CG200800 Rh7AG275000 Rh7DG346800
rosa_wichuraiana	Rw4G010230 Rw5G035120 Rw6G007570 Rw6G041520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	161
AcsI	RAATTY	1 cut(s)	137
AcuI	CTGAAG	1 cut(s)	443
AfiI	CCNNNNNNNGG	1 cut(s)	46
AgsI	TTSAA	5 cut(s)	184, 298, 379, 469, 550
AluBI	AGCT	1 cut(s)	253
AluI	AGCT	1 cut(s)	253
AlwI	GGATC	1 cut(s)	161
AoxI	GGCC	2 cut(s)	117, 335
ApoI	RAATTY	1 cut(s)	137
AspS9I	GGNCC	2 cut(s)	117, 290
AvaII	GGWCC	1 cut(s)	290
BauI	CACGAG	1 cut(s)	384
BbsI	GAAGAC	1 cut(s)	446
BccI	CCATC	2 cut(s)	178, 281
BfaI	CTAG	2 cut(s)	5, 234
BlpI	GCTNAGC	1 cut(s)	306
Bme18I	GGWCC	1 cut(s)	290
BmgT120I	GGNCC	2 cut(s)	117, 290
BpiI	GAAGAC	1 cut(s)	446
Bpu1102I	GCTNAGC	1 cut(s)	306
BsaJI	CCNNGG	2 cut(s)	16, 40
Bsc4I	CCNNNNNNNGG	1 cut(s)	46
Bse118I	RCCGGY	1 cut(s)	301
BseDI	CCNNGG	2 cut(s)	16, 40
BseGI	GGATG	1 cut(s)	433
BseLI	CCNNNNNNNGG	1 cut(s)	46
BseMII	CTCAG	1 cut(s)	162
BseYI	CCCAGC	1 cut(s)	249
BsgI	GTGCAG	1 cut(s)	368
BshFI	GGCC	2 cut(s)	119, 337
BsiSI	CCGG	1 cut(s)	302
BslI	CCNNNNNNNGG	1 cut(s)	46
BsnI	GGCC	2 cut(s)	119, 337
Bsp143I	GATC	3 cut(s)	100, 166, 311
Bsp1720I	GCTNAGC	1 cut(s)	306
BspANI	GGCC	2 cut(s)	119, 337
BspCNI	CTCAG	1 cut(s)	161
BspPI	GGATC	1 cut(s)	161
BsrFI	RCCGGY	1 cut(s)	301
BssAI	RCCGGY	1 cut(s)	301
BssECI	CCNNGG	2 cut(s)	16, 40
BssMI	GATC	3 cut(s)	100, 166, 311
BssSI	CACGAG	1 cut(s)	384
BssT1I	CCWWGG	2 cut(s)	16, 40
Bst2BI	CACGAG	1 cut(s)	384
Bst4CI	ACNGT	1 cut(s)	159
BstAPI	GCANNNNNTGC	1 cut(s)	355
BstC8I	GCNNGC	3 cut(s)	83, 303, 404
BstDEI	CTNAG	3 cut(s)	148, 306, 332
BstENI	CCTNNNNNAGG	1 cut(s)	44
BstF5I	GGATG	1 cut(s)	433
BstKTI	GATC	3 cut(s)	103, 169, 314
BstMBI	GATC	3 cut(s)	100, 166, 311
BstMWI	GCNNNNNNNGC	2 cut(s)	307, 355
BstV2I	GAAGAC	1 cut(s)	446
BsuRI	GGCC	2 cut(s)	119, 337
BtsCI	GGATG	1 cut(s)	433
Cac8I	GCNNGC	3 cut(s)	83, 303, 404
Cfr10I	RCCGGY	1 cut(s)	301
Cfr13I	GGNCC	2 cut(s)	117, 290
CviAII	CATG	4 cut(s)	86, 134, 202, 229
DdeI	CTNAG	3 cut(s)	148, 306, 332
DpnI	GATC	3 cut(s)	102, 168, 313
DpnII	GATC	3 cut(s)	100, 166, 311
Eco130I	CCWWGG	2 cut(s)	16, 40
Eco147I	AGGCCT	1 cut(s)	337
Eco47I	GGWCC	1 cut(s)	290
Eco57I	CTGAAG	1 cut(s)	443
EcoNI	CCTNNNNNAGG	1 cut(s)	44
EcoRI	GAATTC	1 cut(s)	137
EcoT14I	CCWWGG	2 cut(s)	16, 40
EcoT22I	ATGCAT	1 cut(s)	360
ErhI	CCWWGG	2 cut(s)	16, 40
FaeI	CATG	4 cut(s)	89, 137, 205, 232
FaiI	YATR	9 cut(s)	36, 87, 135, 203, 230, 360, 362, 397, 399
FatI	CATG	4 cut(s)	85, 133, 201, 228
FauNDI	CATATG	1 cut(s)	397
FokI	GGATG	1 cut(s)	440
FspBI	CTAG	2 cut(s)	5, 234
GsaI	CCCAGC	1 cut(s)	253
HaeIII	GGCC	2 cut(s)	119, 337
HapII	CCGG	1 cut(s)	302
Hin1II	CATG	4 cut(s)	89, 137, 205, 232
HincII	GTYRAC	1 cut(s)	510
HindII	GTYRAC	1 cut(s)	510
HinfI	GANTC	1 cut(s)	244
HpaII	CCGG	1 cut(s)	302
Hpy166II	GTNNAC	1 cut(s)	510
Hpy188I	TCNGA	2 cut(s)	143, 151
Hpy188III	TCNNGA	2 cut(s)	174, 215
Hpy8I	GTNNAC	1 cut(s)	510
HpyAV	CCTTC	5 cut(s)	71, 178, 221, 361, 418
HpyCH4III	ACNGT	1 cut(s)	159
HpyCH4IV	ACGT	1 cut(s)	471
HpyCH4V	TGCA	5 cut(s)	133, 201, 228, 349, 358
HpyF10VI	GCNNNNNNNGC	2 cut(s)	307, 355
HpyF3I	CTNAG	3 cut(s)	148, 306, 332
HpySE526I	ACGT	1 cut(s)	471
Hsp92II	CATG	4 cut(s)	89, 137, 205, 232
KroI	GCCGGC	1 cut(s)	301
KroNI	GCCGGC	1 cut(s)	303
Kzo9I	GATC	3 cut(s)	100, 166, 311
LpnPI	CCDG	6 cut(s)	100, 228, 263, 297, 315, 351
MaeI	CTAG	2 cut(s)	5, 234
MaeII	ACGT	1 cut(s)	471
MalI	GATC	3 cut(s)	102, 168, 313
MboI	GATC	3 cut(s)	100, 166, 311
MboII	GAAGA	3 cut(s)	402, 446, 538
MluCI	AATT	3 cut(s)	27, 104, 137
MnlI	CCTC	7 cut(s)	40, 137, 145, 214, 380, 436, 487
Mph1103I	ATGCAT	1 cut(s)	360
MroNI	GCCGGC	1 cut(s)	301
MseI	TTAA	3 cut(s)	30, 107, 126
MspI	CCGG	1 cut(s)	302
MwoI	GCNNNNNNNGC	2 cut(s)	307, 355
NaeI	GCCGGC	1 cut(s)	303
NdeI	CATATG	1 cut(s)	397
NdeII	GATC	3 cut(s)	100, 166, 311
NgoMIV	GCCGGC	1 cut(s)	301
NlaIII	CATG	4 cut(s)	89, 137, 205, 232
NsiI	ATGCAT	1 cut(s)	360
PceI	AGGCCT	1 cut(s)	337
PdiI	GCCGGC	1 cut(s)	303
PfeI	GAWTC	1 cut(s)	244
PspFI	CCCAGC	1 cut(s)	249
PspPI	GGNCC	2 cut(s)	117, 290
SaqAI	TTAA	3 cut(s)	30, 107, 126
Sau3AI	GATC	3 cut(s)	100, 166, 311
Sau96I	GGNCC	2 cut(s)	117, 290
SetI	ASST	6 cut(s)	51, 126, 225, 255, 454, 474
SinI	GGWCC	1 cut(s)	290
Sse9I	AATT	3 cut(s)	27, 104, 137
SseBI	AGGCCT	1 cut(s)	337
SspI	AATATT	1 cut(s)	196
SspMI	CTAG	2 cut(s)	5, 234
StuI	AGGCCT	1 cut(s)	337
StyI	CCWWGG	2 cut(s)	16, 40
TaaI	ACNGT	1 cut(s)	159
TaiI	ACGT	1 cut(s)	474
TaqI	TCGA	1 cut(s)	501
TasI	AATT	3 cut(s)	27, 104, 137
TfiI	GAWTC	1 cut(s)	244
Tru1I	TTAA	3 cut(s)	30, 107, 126
Tru9I	TTAA	3 cut(s)	30, 107, 126
TspDTI	ATGAA	7 cut(s)	90, 150, 218, 257, 264, 447, 505
TspGWI	ACGGA	1 cut(s)	379
VpaK11BI	GGWCC	1 cut(s)	290
XagI	CCTNNNNNAGG	1 cut(s)	44
XapI	RAATTY	1 cut(s)	137
XspI	CTAG	2 cut(s)	5, 234
Zsp2I	ATGCAT	1 cut(s)	360

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.