Rmu_sc0002316.1_g000083

Proteasome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002316.1
Physical Location & Seq
Reverse (-)
392735 .. 393070
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002316.1_g000083.1.cds

Sequence Viewer

Length: 234 bp
atgaaggttctagtgaagtgtcttgtgattgatggaacattgagtgtagatgctttggctgatggggcttctcagaacgttcattgtgaatttaatgttggtgattatgtgcaagaaaatgagggaagtaattactcatcacagtttaagaacttggacaccctagtgaagaatctcaaccctcaagttttgttgaaattggaggagtcttccacacccaaggcaacaaggtaa

Protein Analysis

77

Amino Acids

8.43

Weight (kDa)

4.87

Isoelectric Point (pI)

17.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 78
AcsI RAATTY 1 cut(s) 89
AgsI TTSAA 1 cut(s) 196
AjuI GAANNNNNNNTTGG 2 cut(s) 81, 113
AleI CACNNNNGTG 1 cut(s) 164
ApoI RAATTY 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 113
BbsI GAAGAC 1 cut(s) 201
BccI CCATC 2 cut(s) 26, 56
BfaI CTAG 2 cut(s) 11, 164
BmsI GCATC 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 201
BpuEI CTTGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 219
BseMII CTCAG 1 cut(s) 86
BseRI GAGGAG 1 cut(s) 218
BspCNI CTCAG 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 219
BssT1I CCWWGG 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 144
BstDEI CTNAG 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstV2I GAAGAC 1 cut(s) 201
CviJI RGCY 2 cut(s) 59, 68
CviKI_1 RGCY 2 cut(s) 59, 68
DdeI CTNAG 1 cut(s) 72
Eco130I CCWWGG 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 219
ErhI CCWWGG 1 cut(s) 219
FaiI YATR 1 cut(s) 108
FspBI CTAG 2 cut(s) 11, 164
HinfI GANTC 2 cut(s) 172, 206
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 75
HpyCH4III ACNGT 1 cut(s) 144
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 1 cut(s) 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 72
HpySE526I ACGT 1 cut(s) 78
LweI GCATC 1 cut(s) 40
MaeI CTAG 2 cut(s) 11, 164
MaeII ACGT 1 cut(s) 78
MboII GAAGA 2 cut(s) 181, 201
MluCI AATT 3 cut(s) 89, 130, 197
MlyI GAGTC 1 cut(s) 215
MnlI CCTC 3 cut(s) 115, 192, 196
MseI TTAA 2 cut(s) 93, 147
MslI CAYNNNNRTG 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 65
OliI CACNNNNGTG 1 cut(s) 164
PfeI GAWTC 1 cut(s) 172
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
Psp1406I AACGTT 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 164
SaqAI TTAA 2 cut(s) 93, 147
SchI GAGTC 1 cut(s) 215
SetI ASST 3 cut(s) 9, 81, 233
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 6 cut(s) 23, 35, 125, 166, 176, 197
SmiMI CAYNNNNRTG 1 cut(s) 164
SmlI CTYRAG 1 cut(s) 183
SmoI CTYRAG 1 cut(s) 183
Sse9I AATT 3 cut(s) 89, 130, 197
SspMI CTAG 2 cut(s) 11, 164
StyI CCWWGG 1 cut(s) 219
TaaI ACNGT 1 cut(s) 144
TaiI ACGT 1 cut(s) 81
TasI AATT 3 cut(s) 89, 130, 197
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 2 cut(s) 93, 147
Tru9I TTAA 2 cut(s) 93, 147
TspDTI ATGAA 2 cut(s) 17, 71
XapI RAATTY 1 cut(s) 89
XspI CTAG 2 cut(s) 11, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.