Rmu_sc0002426.1_g000013

EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002426.1
OG0001544
Physical Location & Seq
Forward (+)
39848 .. 41867
2020 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002426.1_g000013.1.cds

Sequence Viewer

Length: 351 bp
atggttaacactgtgggattacatctgttgagcctaattaggaagatcggaggtgggtttttcattcttgggccgctggtagcccggttcggtgaggctgtggttgcattacccggtggctgtgacattggggctagaccggtggacctttacattcggggtcttcaagctcttggtgctgttgtggagatgaaggatggaaaagttcaggcatatgcattaaatggaagaggattggttgggggaagttttcaacttgattacccttgcgttggggcaacagaaacccttctgatggctgcatgtatggctgatggaacaactatactgtccagtgttgccagagtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EPSP_synthase

Protein Analysis

116

Amino Acids

11.94

Weight (kDa)

7.72

Isoelectric Point (pI)

27.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 74
AfiI CCNNNNNNNGG 2 cut(s) 272, 295
AgeI ACCGGT 1 cut(s) 139
AgsI TTSAA 2 cut(s) 167, 254
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AoxI GGCC 1 cut(s) 71
ApeKI GCWGC 1 cut(s) 299
AsiGI ACCGGT 1 cut(s) 139
Asp700I GAANNNNTTC 1 cut(s) 288
AspS9I GGNCC 2 cut(s) 71, 145
AsuC2I CCSGG 2 cut(s) 85, 114
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 1 cut(s) 145
BbsI GAAGAC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 286
BccI CCATC 3 cut(s) 191, 289, 308
BcnI CCSGG 2 cut(s) 85, 114
BfaI CTAG 1 cut(s) 135
BisI GCNGC 2 cut(s) 74, 300
BlsI GCNGC 2 cut(s) 75, 301
Bme1390I CCNGG 2 cut(s) 85, 114
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 2 cut(s) 71, 145
BmrFI CCNGG 2 cut(s) 85, 114
BpiI GAAGAC 1 cut(s) 155
BpuMI CCSGG 2 cut(s) 85, 114
BsaWI WCCGGW 1 cut(s) 139
Bsc4I CCNNNNNNNGG 2 cut(s) 272, 295
Bse118I RCCGGY 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 333
BseGI GGATG 1 cut(s) 202
BseLI CCNNNNNNNGG 2 cut(s) 272, 295
BseNI ACTGG 1 cut(s) 333
BseXI GCAGC 1 cut(s) 286
BshFI GGCC 1 cut(s) 73
BshTI ACCGGT 1 cut(s) 139
BsiSI CCGG 3 cut(s) 85, 114, 140
BslI CCNNNNNNNGG 2 cut(s) 272, 295
BsnI GGCC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 45
BspACI CCGC 1 cut(s) 74
BspANI GGCC 1 cut(s) 73
BsrFI RCCGGY 1 cut(s) 139
BsrI ACTGG 1 cut(s) 333
BssAI RCCGGY 1 cut(s) 139
BssMI GATC 1 cut(s) 45
Bst4CI ACNGT 2 cut(s) 13, 330
Bst6I CTCTTC 1 cut(s) 223
BstF5I GGATG 1 cut(s) 202
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstMWI GCNNNNNNNGC 3 cut(s) 104, 176, 308
BstNSI RCATGY 1 cut(s) 306
BstSCI CCNGG 2 cut(s) 83, 112
BstV1I GCAGC 1 cut(s) 286
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 73
BtsCI GGATG 1 cut(s) 202
BtsIMutI CAGTG 2 cut(s) 9, 340
Cfr10I RCCGGY 1 cut(s) 139
Cfr13I GGNCC 2 cut(s) 71, 145
CspAI ACCGGT 1 cut(s) 139
CviAII CATG 1 cut(s) 303
CviJI RGCY 9 cut(s) 33, 73, 83, 98, 120, 134, 170, 299, 311
CviKI_1 RGCY 9 cut(s) 33, 73, 83, 98, 120, 134, 170, 299, 311
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eam1104I CTCTTC 1 cut(s) 223
EarI CTCTTC 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 145
EcoT22I ATGCAT 1 cut(s) 220
FaeI CATG 1 cut(s) 306
FaiI YATR 6 cut(s) 214, 216, 304, 308, 326, 349
FatI CATG 1 cut(s) 302
FauNDI CATATG 1 cut(s) 214
Fnu4HI GCNGC 2 cut(s) 74, 300
FokI GGATG 1 cut(s) 209
Fsp4HI GCNGC 2 cut(s) 74, 300
FspBI CTAG 1 cut(s) 135
GluI GCNGC 2 cut(s) 74, 300
HaeIII GGCC 1 cut(s) 73
HapII CCGG 3 cut(s) 85, 114, 140
Hin1II CATG 1 cut(s) 306
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HpaI GTTAAC 1 cut(s) 7
HpaII CCGG 3 cut(s) 85, 114, 140
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 2 cut(s) 7, 145
Hpy188I TCNGA 2 cut(s) 50, 294
Hpy8I GTNNAC 2 cut(s) 7, 145
HpyAV CCTTC 2 cut(s) 187, 299
HpyCH4III ACNGT 2 cut(s) 13, 330
HpyCH4V TGCA 3 cut(s) 107, 218, 302
HpyF10VI GCNNNNNNNGC 3 cut(s) 104, 176, 308
Hsp92II CATG 1 cut(s) 306
KspAI GTTAAC 1 cut(s) 7
Kzo9I GATC 1 cut(s) 45
LpnPI CCDG 6 cut(s) 62, 98, 127, 153, 194, 346
Lsp1109I GCAGC 1 cut(s) 286
MaeI CTAG 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 3 cut(s) 55, 155, 240
MluCI AATT 1 cut(s) 36
MnlI CCTC 3 cut(s) 44, 88, 224
Mph1103I ATGCAT 1 cut(s) 220
MroXI GAANNNNTTC 1 cut(s) 288
MseI TTAA 2 cut(s) 6, 221
MspA1I CMGCKG 1 cut(s) 76
MspI CCGG 3 cut(s) 85, 114, 140
MspR9I CCNGG 2 cut(s) 85, 114
MwoI GCNNNNNNNGC 3 cut(s) 104, 176, 308
NciI CCSGG 2 cut(s) 85, 114
NdeI CATATG 1 cut(s) 214
NdeII GATC 1 cut(s) 45
NlaIII CATG 1 cut(s) 306
NmuCI GTSAC 1 cut(s) 122
NsiI ATGCAT 1 cut(s) 220
NspI RCATGY 1 cut(s) 306
PdmI GAANNNNTTC 1 cut(s) 288
PinAI ACCGGT 1 cut(s) 139
PkrI GCNGC 2 cut(s) 75, 301
PspPI GGNCC 2 cut(s) 71, 145
SaqAI TTAA 2 cut(s) 6, 221
SatI GCNGC 2 cut(s) 74, 300
Sau3AI GATC 1 cut(s) 45
Sau96I GGNCC 2 cut(s) 71, 145
ScrFI CCNGG 2 cut(s) 85, 114
SetI ASST 3 cut(s) 55, 150, 172
SinI GGWCC 1 cut(s) 145
Sse9I AATT 1 cut(s) 36
SsiI CCGC 1 cut(s) 74
SspMI CTAG 1 cut(s) 135
StyD4I CCNGG 2 cut(s) 83, 112
TaaI ACNGT 2 cut(s) 13, 330
TasI AATT 1 cut(s) 36
TauI GCSGC 1 cut(s) 76
Tru1I TTAA 2 cut(s) 6, 221
Tru9I TTAA 2 cut(s) 6, 221
TscAI CASTG 2 cut(s) 16, 340
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 1 cut(s) 299
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 52, 206
TspRI CASTG 2 cut(s) 16, 340
VpaK11BI GGWCC 1 cut(s) 145
XceI RCATGY 1 cut(s) 306
XmnI GAANNNNTTC 1 cut(s) 288
XspI CTAG 1 cut(s) 135
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.