Rmu_sc0004790.1_g000012

EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004790.1
Physical Location & Seq
Forward (+)
43671 .. 43992
322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004790.1_g000012.1.cds

Sequence Viewer

Length: 210 bp
atgaacgaactgcggaagcttggagcaaaaattctagtctctgcaagctctgctctggttttcgggaaagataatagaaatggtttgtctggttcctgccttgctgcaactgacctcagaggtgggatatcattggtattagctgcattggctgcagaaggtactactgagatcagcggtgttgctcatattgtggttatgagaatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.03

Weight (kDa)

9.18

Isoelectric Point (pI)

29.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 177
AcsI RAATTY 1 cut(s) 30
AfaI GTAC 1 cut(s) 163
AluBI AGCT 3 cut(s) 19, 48, 143
AluI AGCT 3 cut(s) 19, 48, 143
Alw26I GTCTC 1 cut(s) 43
ApeKI GCWGC 3 cut(s) 104, 143, 152
ApoI RAATTY 1 cut(s) 30
BbvI GCAGC 3 cut(s) 91, 130, 139
BcoDI GTCTC 1 cut(s) 43
BfaI CTAG 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 153
BisI GCNGC 3 cut(s) 105, 144, 153
BlsI GCNGC 3 cut(s) 106, 145, 154
BmiI GGNNCC 1 cut(s) 94
BseMII CTCAG 2 cut(s) 130, 159
BseXI GCAGC 3 cut(s) 91, 130, 139
BsmAI GTCTC 1 cut(s) 43
Bsp143I GATC 1 cut(s) 171
BspACI CCGC 2 cut(s) 13, 177
BspCNI CTCAG 2 cut(s) 129, 160
BspLI GGNNCC 1 cut(s) 94
BspMAI CTGCAG 1 cut(s) 157
BssMI GATC 1 cut(s) 171
BstAPI GCANNNNNTGC 2 cut(s) 50, 152
BstC8I GCNNGC 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 116, 168
BstKTI GATC 1 cut(s) 174
BstMAI GTCTC 1 cut(s) 43
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 3 cut(s) 50, 149, 152
BstSFI CTRYAG 1 cut(s) 153
BstV1I GCAGC 3 cut(s) 91, 130, 139
Cac8I GCNNGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 162
CviJI RGCY 4 cut(s) 19, 48, 143, 152
CviKI_1 RGCY 4 cut(s) 19, 48, 143, 152
CviQI GTAC 1 cut(s) 162
DdeI CTNAG 2 cut(s) 116, 168
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco32I GATATC 1 cut(s) 129
EcoRV GATATC 1 cut(s) 129
FaiI YATR 2 cut(s) 189, 200
Fnu4HI GCNGC 3 cut(s) 105, 144, 153
Fsp4HI GCNGC 3 cut(s) 105, 144, 153
FspBI CTAG 1 cut(s) 35
GluI GCNGC 3 cut(s) 105, 144, 153
HindIII AAGCTT 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 4 cut(s) 44, 107, 146, 155
HpyF10VI GCNNNNNNNGC 3 cut(s) 50, 149, 152
HpyF3I CTNAG 2 cut(s) 116, 168
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 3 cut(s) 41, 75, 109
Lsp1109I GCAGC 3 cut(s) 91, 130, 139
MaeI CTAG 1 cut(s) 35
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MluCI AATT 1 cut(s) 30
MnlI CCTC 2 cut(s) 113, 125
MspA1I CMGCKG 1 cut(s) 177
MwoI GCNNNNNNNGC 3 cut(s) 50, 149, 152
NdeII GATC 1 cut(s) 171
NlaIV GGNNCC 1 cut(s) 94
PkrI GCNGC 3 cut(s) 106, 145, 154
PspN4I GGNNCC 1 cut(s) 94
PstI CTGCAG 1 cut(s) 157
RsaI GTAC 1 cut(s) 163
RsaNI GTAC 1 cut(s) 162
SatI GCNGC 3 cut(s) 105, 144, 153
Sau3AI GATC 1 cut(s) 171
SetI ASST 6 cut(s) 21, 50, 117, 124, 145, 163
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 8 cut(s) 32, 47, 57, 68, 76, 102, 108, 113
Sse9I AATT 1 cut(s) 30
SsiI CCGC 2 cut(s) 13, 177
SspMI CTAG 1 cut(s) 35
TasI AATT 1 cut(s) 30
TseI GCWGC 3 cut(s) 104, 143, 152
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 30
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.