Rmu_sc0014478.1_g000005

EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014478.1
Physical Location & Seq
Reverse (-)
13291 .. 13669
379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014478.1_g000005.1.cds

Sequence Viewer

Length: 267 bp
ctgcggaagcttggagcaaaaattcaagtctgtgcaagctctactctggtttttgggaaagataatagaagtggtttctctggttcctgccttgctgcaactgaccttagaggtgggatatcattggtattagctgcattggctgcagaaggtactactgagatcagcagtgttgcccatattgaccgtggttatgagaatgtagatacacaacttcatatgctgggagccgatatcaaaagattaacagcccctgcttcttcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.08

Weight (kDa)

8.03

Isoelectric Point (pI)

31.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AcsI RAATTY 1 cut(s) 21
AfaI GTAC 1 cut(s) 154
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 3 cut(s) 10, 39, 134
AluI AGCT 3 cut(s) 10, 39, 134
AlwNI CAGNNNCTG 1 cut(s) 254
ApeKI GCWGC 3 cut(s) 95, 134, 143
ApoI RAATTY 1 cut(s) 21
BbvI GCAGC 3 cut(s) 82, 121, 130
BfaI CTAG 1 cut(s) 265
BfmI CTRYAG 1 cut(s) 144
BisI GCNGC 3 cut(s) 96, 135, 144
BlsI GCNGC 3 cut(s) 97, 136, 145
BmiI GGNNCC 2 cut(s) 85, 229
BsaJI CCNNGG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 150
BseXI GCAGC 3 cut(s) 82, 121, 130
BseYI CCCAGC 1 cut(s) 223
Bsp143I GATC 1 cut(s) 162
BspACI CCGC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 151
BspLI GGNNCC 2 cut(s) 85, 229
BspMAI CTGCAG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 188
BstAPI GCANNNNNTGC 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 37
BstDEI CTNAG 2 cut(s) 107, 159
BstDSI CCRYGG 1 cut(s) 187
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstMWI GCNNNNNNNGC 2 cut(s) 140, 143
BstSFI CTRYAG 1 cut(s) 144
BstV1I GCAGC 3 cut(s) 82, 121, 130
BtgI CCRYGG 1 cut(s) 187
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 37
CaiI CAGNNNCTG 1 cut(s) 254
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 6 cut(s) 10, 39, 134, 143, 230, 251
CviKI_1 RGCY 6 cut(s) 10, 39, 134, 143, 230, 251
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 2 cut(s) 107, 159
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
Eco32I GATATC 2 cut(s) 120, 235
EcoRV GATATC 2 cut(s) 120, 235
FaiI YATR 4 cut(s) 180, 195, 219, 221
FauNDI CATATG 1 cut(s) 219
Fnu4HI GCNGC 3 cut(s) 96, 135, 144
Fsp4HI GCNGC 3 cut(s) 96, 135, 144
FspBI CTAG 1 cut(s) 265
GluI GCNGC 3 cut(s) 96, 135, 144
GsaI CCCAGC 1 cut(s) 227
HindIII AAGCTT 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4V TGCA 4 cut(s) 35, 98, 137, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 143
HpyF3I CTNAG 2 cut(s) 107, 159
Kzo9I GATC 1 cut(s) 162
LmnI GCTCC 2 cut(s) 14, 227
LpnPI CCDG 4 cut(s) 32, 66, 100, 209
Lsp1109I GCAGC 3 cut(s) 82, 121, 130
MaeI CTAG 1 cut(s) 265
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MboII GAAGA 1 cut(s) 252
MluCI AATT 1 cut(s) 21
MnlI CCTC 1 cut(s) 104
MseI TTAA 1 cut(s) 245
MwoI GCNNNNNNNGC 2 cut(s) 140, 143
NdeI CATATG 1 cut(s) 219
NdeII GATC 1 cut(s) 162
NlaIV GGNNCC 2 cut(s) 85, 229
PkrI GCNGC 3 cut(s) 97, 136, 145
PspFI CCCAGC 1 cut(s) 223
PspN4I GGNNCC 2 cut(s) 85, 229
PstI CTGCAG 1 cut(s) 148
PstNI CAGNNNCTG 1 cut(s) 254
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SaqAI TTAA 1 cut(s) 245
SatI GCNGC 3 cut(s) 96, 135, 144
Sau3AI GATC 1 cut(s) 162
SetI ASST 6 cut(s) 12, 41, 108, 115, 136, 154
SfcI CTRYAG 1 cut(s) 144
SgeI CNNG 9 cut(s) 23, 38, 48, 59, 93, 99, 104, 200, 236
Sse9I AATT 1 cut(s) 21
SsiI CCGC 1 cut(s) 4
SspMI CTAG 1 cut(s) 265
TaaI ACNGT 1 cut(s) 188
TasI AATT 1 cut(s) 21
Tru1I TTAA 1 cut(s) 245
Tru9I TTAA 1 cut(s) 245
TscAI CASTG 1 cut(s) 175
TseI GCWGC 3 cut(s) 95, 134, 143
TspDTI ATGAA 1 cut(s) 206
TspRI CASTG 1 cut(s) 175
XapI RAATTY 1 cut(s) 21
XcmI CCANNNNNNNNNTGG 1 cut(s) 185
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.