Rroxscaffold_1G00039380

EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
56992292 .. 56995992
3701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00039380.1

Sequence Viewer

Length: 276 bp
ATGGCTGCATGTATGGCTGATGGAACAACTATACTGTCCAATGTTGCCAGAGAACCAGAGGTGGTTGATCTTGCTCGATTTCTGACTAACAGTGGGGCCTTTGTGGAAGGAGCAGGAAGCAACAAGCTTGTCATCAAGGGAAAATCTCATTTGCATGGTTGTAAATGTACTATTGCACCTGATCGTATTGAAGCAGGCACATTTATACTTGCTGCAGCTATTACTCGCTCATTCATTTCAATTTCACCTGTCATTCCTCCCAAGTTTCCTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

9.51

Weight (kDa)

8.59

Isoelectric Point (pI)

47.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EPSP_synthase PF00275 1 - 82 9.7e-21 EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 169
AgsI TTSAA 2 cut(s) 191, 240
AluBI AGCT 2 cut(s) 127, 218
AluI AGCT 2 cut(s) 127, 218
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 3 cut(s) 5, 212, 215
AspS9I GGNCC 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 237
BbvI GCAGC 2 cut(s) 199, 227
BccI CCATC 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 213
BisI GCNGC 3 cut(s) 6, 213, 216
BlsI GCNGC 3 cut(s) 7, 214, 217
BmgT120I GGNCC 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 97
BseXI GCAGC 2 cut(s) 199, 227
BshFI GGCC 1 cut(s) 98
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 67, 181
BspANI GGCC 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 97
BspMAI CTGCAG 1 cut(s) 217
BssMI GATC 2 cut(s) 67, 181
Bst4CI ACNGT 2 cut(s) 36, 92
BstC8I GCNNGC 1 cut(s) 196
BstKTI GATC 2 cut(s) 70, 184
BstMBI GATC 2 cut(s) 67, 181
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 213
BstV1I GCAGC 2 cut(s) 199, 227
BsuRI GGCC 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 96
Csp6I GTAC 1 cut(s) 168
CviAII CATG 2 cut(s) 9, 155
CviJI RGCY 5 cut(s) 5, 17, 98, 127, 218
CviKI_1 RGCY 5 cut(s) 5, 17, 98, 127, 218
CviQI GTAC 1 cut(s) 168
DpnI GATC 2 cut(s) 69, 183
DpnII GATC 2 cut(s) 67, 181
EcoO109I RGGNCCY 1 cut(s) 96
FaeI CATG 2 cut(s) 12, 158
FaiI YATR 5 cut(s) 10, 14, 32, 156, 206
FatI CATG 2 cut(s) 8, 154
Fnu4HI GCNGC 3 cut(s) 6, 213, 216
Fsp4HI GCNGC 3 cut(s) 6, 213, 216
GluI GCNGC 3 cut(s) 6, 213, 216
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 2 cut(s) 12, 158
HindIII AAGCTT 1 cut(s) 125
HphI GGTGA 1 cut(s) 237
Hpy188I TCNGA 2 cut(s) 84, 275
HpyAV CCTTC 1 cut(s) 101
HpyCH4III ACNGT 2 cut(s) 36, 92
HpyCH4V TGCA 4 cut(s) 8, 154, 176, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
Hsp92II CATG 2 cut(s) 12, 158
Kzo9I GATC 2 cut(s) 67, 181
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 6 cut(s) 61, 69, 99, 180, 192, 261
Lsp1109I GCAGC 2 cut(s) 199, 227
MalI GATC 2 cut(s) 69, 183
MboI GATC 2 cut(s) 67, 181
MluCI AATT 1 cut(s) 240
MnlI CCTC 2 cut(s) 52, 267
MslI CAYNNNNRTG 1 cut(s) 153
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeII GATC 2 cut(s) 67, 181
NlaIII CATG 2 cut(s) 12, 158
NlaIV GGNNCC 1 cut(s) 97
NspI RCATGY 1 cut(s) 12
PkrI GCNGC 3 cut(s) 7, 214, 217
PspN4I GGNNCC 1 cut(s) 97
PspPI GGNCC 1 cut(s) 96
PstI CTGCAG 1 cut(s) 217
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
RseI CAYNNNNRTG 1 cut(s) 153
SatI GCNGC 3 cut(s) 6, 213, 216
Sau3AI GATC 2 cut(s) 67, 181
Sau96I GGNCC 1 cut(s) 96
SetI ASST 5 cut(s) 63, 129, 181, 220, 250
SfcI CTRYAG 1 cut(s) 213
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 1 cut(s) 240
TaaI ACNGT 2 cut(s) 36, 92
TaqI TCGA 1 cut(s) 76
TasI AATT 1 cut(s) 240
TatI WGTACW 1 cut(s) 167
TscAI CASTG 1 cut(s) 97
TseI GCWGC 3 cut(s) 5, 212, 215
TspDTI ATGAA 1 cut(s) 223
TspRI CASTG 1 cut(s) 97
XceI RCATGY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.