Rmu_ssc0000050.1_g000028

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000050.1
OG0000590
Physical Location & Seq
Forward (+)
116281 .. 117020
740 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000050.1_g000028.1.cds

Sequence Viewer

Length: 591 bp
atgaccagggaggcatgtcaagaatatgctcgagaagttgaaaagctagctctaaagttgatgggacttattgccttaagtctgggcttgccggaagacaggttcaaaggctacttcaaagaccaaaccactcgtatcagactcaatcactatccaccttgcccttccccggagttagcccttggtgttggtcgccacaaggatggtggcgctctaactgtgctagctcaagatgatgtaggaggattggaagtgaagagaaaaacagatggagagtgggttagggtaaatcccaccccaaatgcttatatcatcaatcttggtgacactcttcaggtttggagcaatgagagatatgagagtacagaacacagggtgatggtgaattcagagaaggaaaggttttctatcccgtacttccttgagccagcacactacaccataataaagcccttggaagagctgatcaatgaacaaaatcctgcaaagtataggccatacagctggggcaagtttacgactcacagaaagctgagtaatttcaagaaactcaatgttgaaaacatccaaattcatgatttcaggatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

196

Amino Acids

22.72

Weight (kDa)

8.44

Isoelectric Point (pI)

31.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000590)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G19000 AT3G19000
fragaria_vesca FvH4_2g07071 FvH4_2g07080 FvH4_2g07080 FvH4_2g07081 FvH4_2g07082 FvH4_2g07082
malus_domestica MD05G1074000.v1.1 MD10G1088100.v1.1 MD10G1088200.v1.1 MD14G1207600.v1.1
prunus_persica Prupe.8G114100_v2.0.a1 Prupe.8G114200_v2.0.a1 Prupe.8G114300_v2.0.a1 Prupe.8G114500_v2.0.a1 Prupe.8G114800_v2.0.a1 Prupe.8G115100_v2.0.a1
pyrus_communis pycom05g06640 pycom05g06660 pycom05g06670 pycom10g07050
rosa_chinensis RchiOBHm_Chr6g0244141 RchiOBHm_Chr6g0259511 RchiOBHm_Chr6g0259521 RchiOBHm_Chr6g0259531 RchiOBHm_Chr6g0259551 RchiOBHm_Chr6g0259561
rosa_laevigata RLG00000014522 RLG00000014523 RLG00000014524 RLG00000014525 RLG00000014526 RLG00000014527
rosa_multiflora Rmu_ssc0000050.1_g000019 Rmu_ssc0000050.1_g000020 Rmu_ssc0000050.1_g000026 Rmu_ssc0000050.1_g000027 Rmu_ssc0000050.1_g000028
rosa_roxburghii Rroxscaffold_7G00206780 Rroxscaffold_7G00206790 Rroxscaffold_7G00206850 Rroxscaffold_7G00206860 Rroxscaffold_7G00206870 Rroxscaffold_7G00206880
rosa_rugosa Rorug05G0589100 Rorug05G0589200.1 Rorug05G0589300 Rorug05G0589400 Rorug05G0589500 Rorug05G0589600
rosa_samantha Rh4CG096000 Rh5BG231700 Rh6AG104900 Rh6AG105000 Rh6AG105100 Rh6AG105500 Rh6AG105600 Rh6BG098500 Rh6BG098700 Rh6BG098800 Rh6BG099000 Rh6BG099100 Rh6CG094200 Rh6CG094300 Rh6CG094400 Rh6CG094500 Rh6CG094600 Rh6DG088300 Rh6DG088400 Rh6DG088500 Rh6DG088600 Rh6DG088700
rosa_wichuraiana Rw0G014270 Rw0G014280 Rw0G014290 Rw6G009080 Rw6G009090 Rw6G009100 Rw6G009110 Rw6G009120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 385, 570
AcuI CTGAAG 1 cut(s) 317
AdeI CACNNNGTG 1 cut(s) 376
AfaI GTAC 2 cut(s) 364, 416
AfiI CCNNNNNNNGG 1 cut(s) 169
AflII CTTAAG 1 cut(s) 76
AgsI TTSAA 5 cut(s) 41, 106, 118, 544, 560
AjnI CCWGG 1 cut(s) 5
AloI GAACNNNNNNTCC 2 cut(s) 86, 118
AluBI AGCT 6 cut(s) 46, 50, 227, 463, 504, 532
AluI AGCT 6 cut(s) 46, 50, 227, 463, 504, 532
Ama87I CYCGRG 1 cut(s) 30
AoxI GGCC 1 cut(s) 494
ApoI RAATTY 2 cut(s) 385, 570
AspLEI GCGC 1 cut(s) 212
AsuC2I CCSGG 1 cut(s) 170
AsuHPI GGTGA 3 cut(s) 335, 388, 394
AsuNHI GCTAGC 2 cut(s) 46, 223
AvaI CYCGRG 1 cut(s) 30
BbsI GAAGAC 1 cut(s) 102
BccI CCATC 4 cut(s) 55, 197, 263, 373
BciT130I CCWGG 1 cut(s) 7
BclI TGATCA 1 cut(s) 465
BcnI CCSGG 1 cut(s) 170
BfaI CTAG 2 cut(s) 47, 224
BfoI RGCGCY 1 cut(s) 213
BfrI CTTAAG 1 cut(s) 76
Bme1390I CCNGG 2 cut(s) 7, 170
BmeT110I CYCGRG 1 cut(s) 30
BmrFI CCNGG 2 cut(s) 7, 170
BmtI GCTAGC 2 cut(s) 50, 227
BpiI GAAGAC 1 cut(s) 102
BpuEI CTTGAG 2 cut(s) 213, 443
BpuMI CCSGG 1 cut(s) 170
BsaJI CCNNGG 4 cut(s) 6, 168, 181, 453
BsaXI ACNNNNNCTCC 2 cut(s) 264, 294
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse3DI GCAATG 1 cut(s) 352
BseBI CCWGG 1 cut(s) 7
BseDI CCNNGG 4 cut(s) 6, 168, 181, 453
BseGI GGATG 2 cut(s) 208, 564
BseLI CCNNNNNNNGG 1 cut(s) 169
BseMI GCAATG 1 cut(s) 352
BseMII CTCAG 1 cut(s) 524
BseYI CCCAGC 1 cut(s) 504
BshFI GGCC 1 cut(s) 496
BsiHKCI CYCGRG 1 cut(s) 30
BsiSI CCGG 2 cut(s) 92, 170
BslFI GGGAC 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 169
BsmFI GGGAC 1 cut(s) 78
BsnI GGCC 1 cut(s) 496
BsoBI CYCGRG 1 cut(s) 30
Bsp143I GATC 1 cut(s) 465
BspANI GGCC 1 cut(s) 496
BspCNI CTCAG 1 cut(s) 525
BspHI TCATGA 1 cut(s) 574
BspOI GCTAGC 2 cut(s) 50, 227
BspQI GCTCTTC 1 cut(s) 453
BspTI CTTAAG 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 352
BssECI CCNNGG 4 cut(s) 6, 168, 181, 453
BssMI GATC 1 cut(s) 465
BssT1I CCWWGG 2 cut(s) 181, 453
Bst2UI CCWGG 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 220
Bst6I CTCTTC 3 cut(s) 251, 336, 453
BstAFI CTTAAG 1 cut(s) 76
BstC8I GCNNGC 4 cut(s) 48, 89, 225, 429
BstDEI CTNAG 1 cut(s) 533
BstF5I GGATG 2 cut(s) 208, 564
BstH2I RGCGCY 1 cut(s) 213
BstHHI GCGC 1 cut(s) 212
BstKTI GATC 1 cut(s) 468
BstMBI GATC 1 cut(s) 465
BstNI CCWGG 1 cut(s) 7
BstNSI RCATGY 1 cut(s) 18
BstSCI CCNGG 2 cut(s) 5, 168
BstV2I GAAGAC 1 cut(s) 102
BstXI CCANNNNNNTGG 2 cut(s) 203, 504
BsuRI GGCC 1 cut(s) 496
BtsCI GGATG 2 cut(s) 208, 564
Cac8I GCNNGC 4 cut(s) 48, 89, 225, 429
CciI TCATGA 1 cut(s) 574
CfoI GCGC 1 cut(s) 212
Csp6I GTAC 2 cut(s) 363, 415
CspCI CAANNNNNGTGG 2 cut(s) 187, 222
CviAII CATG 2 cut(s) 15, 575
CviQI GTAC 2 cut(s) 363, 415
DdeI CTNAG 1 cut(s) 533
DpnI GATC 1 cut(s) 467
DpnII GATC 1 cut(s) 465
DraIII CACNNNGTG 1 cut(s) 376
Eam1104I CTCTTC 3 cut(s) 251, 336, 453
EarI CTCTTC 3 cut(s) 251, 336, 453
Eco130I CCWWGG 2 cut(s) 181, 453
Eco57I CTGAAG 1 cut(s) 317
Eco88I CYCGRG 1 cut(s) 30
EcoRI GAATTC 1 cut(s) 385
EcoRII CCWGG 1 cut(s) 5
EcoT14I CCWWGG 2 cut(s) 181, 453
ErhI CCWWGG 2 cut(s) 181, 453
FaeI CATG 2 cut(s) 18, 578
FaiI YATR 9 cut(s) 16, 27, 309, 357, 443, 492, 499, 576, 589
FaqI GGGAC 1 cut(s) 78
FatI CATG 2 cut(s) 14, 574
FbaI TGATCA 1 cut(s) 465
FokI GGATG 2 cut(s) 215, 551
FspBI CTAG 2 cut(s) 47, 224
GlaI GCGC 1 cut(s) 211
GsaI CCCAGC 1 cut(s) 508
HaeII RGCGCY 1 cut(s) 213
HaeIII GGCC 1 cut(s) 496
HapII CCGG 2 cut(s) 92, 170
HhaI GCGC 1 cut(s) 212
Hin1II CATG 2 cut(s) 18, 578
Hin6I GCGC 1 cut(s) 210
HinP1I GCGC 1 cut(s) 210
HinfI GANTC 2 cut(s) 141, 520
HpaII CCGG 2 cut(s) 92, 170
HphI GGTGA 3 cut(s) 335, 388, 394
Hpy166II GTNNAC 1 cut(s) 516
Hpy188I TCNGA 2 cut(s) 140, 391
Hpy188III TCNNGA 6 cut(s) 20, 32, 230, 544, 575, 583
Hpy8I GTNNAC 1 cut(s) 516
HpyAV CCTTC 2 cut(s) 174, 388
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 485
HpyF3I CTNAG 1 cut(s) 533
Hsp92II CATG 2 cut(s) 18, 578
HspAI GCGC 1 cut(s) 210
Ksp22I TGATCA 1 cut(s) 465
Kzo9I GATC 1 cut(s) 465
LguI GCTCTTC 1 cut(s) 453
LmnI GCTCC 1 cut(s) 342
MaeI CTAG 2 cut(s) 47, 224
MaeIII GTNAC 1 cut(s) 323
MalI GATC 1 cut(s) 467
MboI GATC 1 cut(s) 465
MboII GAAGA 4 cut(s) 107, 268, 323, 470
MluCI AATT 3 cut(s) 385, 538, 570
MlyI GAGTC 2 cut(s) 135, 514
MnlI CCTC 2 cut(s) 4, 236
MseI TTAA 1 cut(s) 77
MslI CAYNNNNRTG 1 cut(s) 201
MspA1I CMGCKG 1 cut(s) 504
MspCI CTTAAG 1 cut(s) 76
MspI CCGG 2 cut(s) 92, 170
MspR9I CCNGG 2 cut(s) 7, 170
MvaI CCWGG 1 cut(s) 7
NciI CCSGG 1 cut(s) 170
NdeII GATC 1 cut(s) 465
NheI GCTAGC 2 cut(s) 46, 223
NlaIII CATG 2 cut(s) 18, 578
NmuCI GTSAC 1 cut(s) 323
NspI RCATGY 1 cut(s) 18
PaeR7I CTCGAG 1 cut(s) 30
PagI TCATGA 1 cut(s) 574
PciSI GCTCTTC 1 cut(s) 453
PleI GAGTC 2 cut(s) 135, 514
PpsI GAGTC 2 cut(s) 135, 514
Psp6I CCWGG 1 cut(s) 5
PspFI CCCAGC 1 cut(s) 504
PspGI CCWGG 1 cut(s) 5
PvuII CAGCTG 1 cut(s) 504
RsaI GTAC 2 cut(s) 364, 416
RsaNI GTAC 2 cut(s) 363, 415
RseI CAYNNNNRTG 1 cut(s) 201
SapI GCTCTTC 1 cut(s) 453
SaqAI TTAA 1 cut(s) 77
Sau3AI GATC 1 cut(s) 465
SchI GAGTC 2 cut(s) 135, 514
ScrFI CCNGG 2 cut(s) 7, 170
Sfr274I CTCGAG 1 cut(s) 30
SlaI CTCGAG 1 cut(s) 30
SmiMI CAYNNNNRTG 1 cut(s) 201
SmlI CTYRAG 4 cut(s) 30, 76, 228, 422
SmoI CTYRAG 4 cut(s) 30, 76, 228, 422
Sse9I AATT 3 cut(s) 385, 538, 570
SspMI CTAG 2 cut(s) 47, 224
StyD4I CCNGG 2 cut(s) 5, 168
StyI CCWWGG 2 cut(s) 181, 453
TaaI ACNGT 1 cut(s) 220
TaqI TCGA 1 cut(s) 31
TasI AATT 3 cut(s) 385, 538, 570
TatI WGTACW 1 cut(s) 362
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TseFI GTSAC 1 cut(s) 323
Tsp45I GTSAC 1 cut(s) 323
TspDTI ATGAA 2 cut(s) 486, 563
Vha464I CTTAAG 1 cut(s) 76
XapI RAATTY 2 cut(s) 385, 570
XceI RCATGY 1 cut(s) 18
XcmI CCANNNNNNNNNTGG 1 cut(s) 203
XhoI CTCGAG 1 cut(s) 30
XspI CTAG 2 cut(s) 47, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.