Rh5BG231700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000590
Physical Location & Seq
Forward (+)
27257351 .. 27258606
1256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG231700.1

Sequence Viewer

Length: 219 bp
ATGTCCTTGAATGGCAAGTTCCAGCATAACAATAGCTTTGGATGTATAAGGATTGCCACATTCTTGAAGGATAAAAACTTAATATTCCTATGGCTGATGTCGTCTATAAGACGCCCTATACGTGCTACTAATAAGCCTCAGGAACTAGATGACGCGGTTCTTAGGAGATTGATTAGTTTTATTTTCTTCTCTCGTACACAACAAGATGGGGAATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.49

Weight (kDa)

10.4

Isoelectric Point (pI)

61.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000590)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G19000 AT3G19000
fragaria_vesca FvH4_2g07071 FvH4_2g07080 FvH4_2g07080 FvH4_2g07081 FvH4_2g07082 FvH4_2g07082
malus_domestica MD05G1074000.v1.1 MD10G1088100.v1.1 MD10G1088200.v1.1 MD14G1207600.v1.1
prunus_persica Prupe.8G114100_v2.0.a1 Prupe.8G114200_v2.0.a1 Prupe.8G114300_v2.0.a1 Prupe.8G114500_v2.0.a1 Prupe.8G114800_v2.0.a1 Prupe.8G115100_v2.0.a1
pyrus_communis pycom05g06640 pycom05g06660 pycom05g06670 pycom10g07050
rosa_chinensis RchiOBHm_Chr6g0244141 RchiOBHm_Chr6g0259511 RchiOBHm_Chr6g0259521 RchiOBHm_Chr6g0259531 RchiOBHm_Chr6g0259551 RchiOBHm_Chr6g0259561
rosa_laevigata RLG00000014522 RLG00000014523 RLG00000014524 RLG00000014525 RLG00000014526 RLG00000014527
rosa_multiflora Rmu_ssc0000050.1_g000019 Rmu_ssc0000050.1_g000020 Rmu_ssc0000050.1_g000026 Rmu_ssc0000050.1_g000027 Rmu_ssc0000050.1_g000028
rosa_roxburghii Rroxscaffold_7G00206780 Rroxscaffold_7G00206790 Rroxscaffold_7G00206850 Rroxscaffold_7G00206860 Rroxscaffold_7G00206870 Rroxscaffold_7G00206880
rosa_rugosa Rorug05G0589100 Rorug05G0589200.1 Rorug05G0589300 Rorug05G0589400 Rorug05G0589500 Rorug05G0589600
rosa_samantha Rh4CG096000 Rh5BG231700 Rh6AG104900 Rh6AG105000 Rh6AG105100 Rh6AG105500 Rh6AG105600 Rh6BG098500 Rh6BG098700 Rh6BG098800 Rh6BG099000 Rh6BG099100 Rh6CG094200 Rh6CG094300 Rh6CG094400 Rh6CG094500 Rh6CG094600 Rh6DG088300 Rh6DG088400 Rh6DG088500 Rh6DG088600 Rh6DG088700
rosa_wichuraiana Rw0G014270 Rw0G014280 Rw0G014290 Rw6G009080 Rw6G009090 Rw6G009100 Rw6G009110 Rw6G009120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 155
AciI CCGC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 212
AcyI GRCGYC 1 cut(s) 112
AfaI GTAC 1 cut(s) 196
AgsI TTSAA 2 cut(s) 10, 67
AluBI AGCT 1 cut(s) 36
AluI AGCT 1 cut(s) 36
ApoI RAATTY 1 cut(s) 212
AxyI CCTNAGG 1 cut(s) 138
BccI CCATC 1 cut(s) 200
BfaI CTAG 1 cut(s) 146
BsaAI YACGTR 1 cut(s) 122
BsaHI GRCGYC 1 cut(s) 112
Bse21I CCTNAGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 152
Bsh1236I CGCG 1 cut(s) 155
BspACI CCGC 1 cut(s) 155
BspCNI CTCAG 1 cut(s) 151
BspFNI CGCG 1 cut(s) 155
BssNI GRCGYC 1 cut(s) 112
BstACI GRCGYC 1 cut(s) 112
BstBAI YACGTR 1 cut(s) 122
BstDEI CTNAG 2 cut(s) 138, 161
BstF5I GGATG 1 cut(s) 47
BstFNI CGCG 1 cut(s) 155
BstUI CGCG 1 cut(s) 155
Bsu36I CCTNAGG 1 cut(s) 138
BtsCI GGATG 1 cut(s) 47
CseI GACGC 2 cut(s) 120, 161
Csp6I GTAC 1 cut(s) 195
CviJI RGCY 3 cut(s) 36, 94, 136
CviKI_1 RGCY 3 cut(s) 36, 94, 136
CviQI GTAC 1 cut(s) 195
DdeI CTNAG 2 cut(s) 138, 161
Eco81I CCTNAGG 1 cut(s) 138
FaiI YATR 5 cut(s) 27, 47, 91, 107, 119
FokI GGATG 1 cut(s) 54
FspBI CTAG 1 cut(s) 146
HgaI GACGC 2 cut(s) 120, 161
Hin1I GRCGYC 1 cut(s) 112
Hpy166II GTNNAC 1 cut(s) 197
Hpy188III TCNNGA 2 cut(s) 64, 140
Hpy8I GTNNAC 1 cut(s) 197
HpyAV CCTTC 1 cut(s) 61
HpyCH4IV ACGT 1 cut(s) 121
HpyF3I CTNAG 2 cut(s) 138, 161
HpySE526I ACGT 1 cut(s) 121
Hsp92I GRCGYC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 35, 125
MaeI CTAG 1 cut(s) 146
MaeII ACGT 1 cut(s) 121
MboII GAAGA 1 cut(s) 178
MluCI AATT 1 cut(s) 212
MnlI CCTC 1 cut(s) 147
MseI TTAA 2 cut(s) 80, 217
MvnI CGCG 1 cut(s) 155
PcsI WCGNNNNNNNCGW 1 cut(s) 118
Ppu21I YACGTR 1 cut(s) 122
RsaI GTAC 1 cut(s) 196
RsaNI GTAC 1 cut(s) 195
SaqAI TTAA 2 cut(s) 80, 217
SetI ASST 2 cut(s) 38, 124
Sse9I AATT 1 cut(s) 212
SsiI CCGC 1 cut(s) 155
SspI AATATT 1 cut(s) 84
SspMI CTAG 1 cut(s) 146
TaiI ACGT 1 cut(s) 124
TasI AATT 1 cut(s) 212
Tru1I TTAA 2 cut(s) 80, 217
Tru9I TTAA 2 cut(s) 80, 217
XapI RAATTY 1 cut(s) 212
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.