Rroxscaffold_1G00028970

Protein of unknown function (DUF1262)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
37386659 .. 37388057
1399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00028970.1

Sequence Viewer

Length: 324 bp
ATGGAAGCTGTCAAGGACGATAGAAATGGTCGTACTGGGTTCTCTTTGTTCAAGGCTTATAATCTAGATAGCCAAAAACTGGTCACTATAGGTCTGAGTTCAGCAATTGTCCAGAATATGAAATGGGTTTTAGAGGCAGGAGGGTGGGTTACTGGGGACGAAAGGGACGCAAGGGTCCAGAAAGTAGAAGAGATTACAAGTAGGTGGAGGAAGTTTGGCTGTTATGTTCTGGTGGAGAGTTTCTACTTGAGAAGAATGAATGGAAGCTTGGTAATGAGACGTGATTTTAGGCACACTAATAACATTCGATGTAAGTGGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.57

Weight (kDa)

9.69

Isoelectric Point (pI)

38.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 60
AasI GACNNNNNNGTC 1 cut(s) 173
AccB7I CCANNNNNTGG 1 cut(s) 79
AfaI GTAC 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 1 cut(s) 52
AjiI CACGTC 1 cut(s) 281
AjuI GAANNNNNNNTTGG 2 cut(s) 251, 283
AluBI AGCT 2 cut(s) 8, 267
AluI AGCT 2 cut(s) 8, 267
Alw26I GTCTC 1 cut(s) 271
AspS9I GGNCC 1 cut(s) 175
AvaII GGWCC 1 cut(s) 175
BcoDI GTCTC 1 cut(s) 271
BfaI CTAG 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 87
Bme18I GGWCC 1 cut(s) 175
BmgBI CACGTC 1 cut(s) 281
BmgT120I GGNCC 1 cut(s) 175
BmiI GGNNCC 1 cut(s) 176
BmrI ACTGGG 2 cut(s) 45, 162
BmuI ACTGGG 2 cut(s) 45, 162
BpuEI CTTGAG 1 cut(s) 268
BsaXI ACNNNNNCTCC 2 cut(s) 132, 162
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 3 cut(s) 40, 84, 157
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 3 cut(s) 40, 84, 157
BslFI GGGAC 2 cut(s) 170, 179
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 1 cut(s) 271
BsmBI CGTCTC 1 cut(s) 271
BsmFI GGGAC 2 cut(s) 170, 179
BspCNI CTCAG 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 176
BsrI ACTGG 3 cut(s) 40, 84, 157
Bst6I CTCTTC 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 95
BstMAI GTCTC 1 cut(s) 271
BstSFI CTRYAG 1 cut(s) 87
BtrI CACGTC 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 175
CseI GACGC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 33
CviJI RGCY 5 cut(s) 8, 56, 72, 219, 267
CviKI_1 RGCY 5 cut(s) 8, 56, 72, 219, 267
CviQI GTAC 1 cut(s) 33
DdeI CTNAG 1 cut(s) 95
DrdI GACNNNNNNGTC 1 cut(s) 173
DseDI GACNNNNNNGTC 1 cut(s) 173
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 175
Esp3I CGTCTC 1 cut(s) 271
FaiI YATR 4 cut(s) 60, 89, 119, 225
FaqI GGGAC 2 cut(s) 170, 179
FspBI CTAG 1 cut(s) 65
HgaI GACGC 1 cut(s) 176
HindIII AAGCTT 1 cut(s) 265
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 3 cut(s) 65, 112, 178
HpyCH4IV ACGT 1 cut(s) 280
HpyF3I CTNAG 1 cut(s) 95
HpySE526I ACGT 1 cut(s) 280
LpnPI CCDG 7 cut(s) 21, 65, 123, 125, 138, 191, 215
MaeI CTAG 1 cut(s) 65
MaeII ACGT 1 cut(s) 280
MaeIII GTNAC 2 cut(s) 82, 148
MboII GAAGA 2 cut(s) 200, 264
MfeI CAATTG 1 cut(s) 105
MluCI AATT 1 cut(s) 105
MnlI CCTC 3 cut(s) 127, 134, 201
MunI CAATTG 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 82
PflMI CCANNNNNTGG 1 cut(s) 79
PsiI TTATAA 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 176
PspPI GGNCC 1 cut(s) 175
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 175
SetI ASST 5 cut(s) 10, 94, 206, 269, 283
SfcI CTRYAG 1 cut(s) 87
SinI GGWCC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 247
SmoI CTYRAG 1 cut(s) 247
Sse9I AATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 65
TaiI ACGT 1 cut(s) 283
TaqI TCGA 1 cut(s) 307
TasI AATT 1 cut(s) 105
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 134, 272
Van91I CCANNNNNTGG 1 cut(s) 79
VpaK11BI GGWCC 1 cut(s) 175
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.