Rorug03G0251200

MOSC domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
23688048 .. 23688765
718 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0251200.1

Sequence Viewer

Length: 159 bp
ATGAATCTTATTGAAAAGACCCACGCAGTAGATACAAGGAAGCCTGCATATAAATGGTTGGGATTGAGAGGAAAAGATGCTACGAGTTCAGCTTCAGACGAGTCTAGAAAAAGAGCCTTTGGAATAGATATCACAAACGTTGTAAGAGGGGCAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.76

Weight (kDa)

10.11

Isoelectric Point (pI)

27.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 78
AgsI TTSAA 1 cut(s) 14
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
BfaI CTAG 1 cut(s) 105
BmsI GCATC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 45
CviJI RGCY 3 cut(s) 43, 92, 116
CviKI_1 RGCY 3 cut(s) 43, 92, 116
Eco32I GATATC 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 78
EcoRV GATATC 1 cut(s) 130
FaiI YATR 2 cut(s) 49, 51
FspBI CTAG 1 cut(s) 105
HinfI GANTC 2 cut(s) 4, 101
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 105
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 138
LpnPI CCDG 1 cut(s) 57
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 105
MaeII ACGT 1 cut(s) 138
MlyI GAGTC 1 cut(s) 110
MnlI CCTC 2 cut(s) 62, 140
MslI CAYNNNNRTG 1 cut(s) 52
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
Psp1406I AACGTT 1 cut(s) 138
RseI CAYNNNNRTG 1 cut(s) 52
SchI GAGTC 1 cut(s) 110
SetI ASST 2 cut(s) 94, 141
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 6 cut(s) 35, 48, 56, 96, 112, 117
SmiMI CAYNNNNRTG 1 cut(s) 52
SspMI CTAG 1 cut(s) 105
TaiI ACGT 1 cut(s) 141
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 104
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.