Rorug05G0519900

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
70409645 .. 70410083
439 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0519900.1

Sequence Viewer

Length: 309 bp
ATGGCAGGCAAGCTCAACACCGGCAGAAATGATGGTTTGGCCATTGATCGTGGTAATGAGGAGGAAGTACTGATAATTCTGAACTTCATGAAGAAGTCGAGGAAAGTTGCTCCTCAAAATGCAATTGGTGATGTTCCCTTGGAATGGTATCAAGATGAGAAGCATATTGGTTATGATCTTATAGGGAAGAAGATTAAAAAGAAGAAAAGTGAGACAAATTGCAATCCTTTCTTGCTAGCGCTGATGATTCCAAAAATTGGTGGGTTTTACATAGGGCTTATGGTACAGAGGCTGAAGTCTGGAGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.4

Weight (kDa)

9.55

Isoelectric Point (pI)

27.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 257
AcoI YGGCCR 1 cut(s) 39
AfaI GTAC 2 cut(s) 69, 285
AfeI AGCGCT 1 cut(s) 240
AfiI CCNNNNNNNGG 2 cut(s) 144, 257
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 206
AlwNI CAGNNNCTG 1 cut(s) 292
Aor51HI AGCGCT 1 cut(s) 240
AoxI GGCC 1 cut(s) 39
AspLEI GCGC 1 cut(s) 241
AsuHPI GGTGA 1 cut(s) 140
AsuNHI GCTAGC 1 cut(s) 235
BalI TGGCCA 1 cut(s) 41
BccI CCATC 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 206
BfaI CTAG 1 cut(s) 236
BfoI RGCGCY 1 cut(s) 242
BmcAI AGTACT 1 cut(s) 69
BmtI GCTAGC 1 cut(s) 239
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 2 cut(s) 144, 257
Bse118I RCCGGY 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 2 cut(s) 144, 257
BseRI GAGGAG 2 cut(s) 74, 102
BshFI GGCC 1 cut(s) 41
BsiSI CCGG 1 cut(s) 21
BslI CCNNNNNNNGG 2 cut(s) 144, 257
BsmAI GTCTC 1 cut(s) 206
BsnI GGCC 1 cut(s) 41
Bsp143I GATC 2 cut(s) 46, 175
BspANI GGCC 1 cut(s) 41
BspHI TCATGA 1 cut(s) 87
BspOI GCTAGC 1 cut(s) 239
BsrFI RCCGGY 1 cut(s) 20
BssAI RCCGGY 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 2 cut(s) 46, 175
BssT1I CCWWGG 1 cut(s) 138
BstC8I GCNNGC 3 cut(s) 7, 11, 237
BstH2I RGCGCY 1 cut(s) 242
BstHHI GCGC 1 cut(s) 241
BstKTI GATC 2 cut(s) 49, 178
BstMAI GTCTC 1 cut(s) 206
BstMBI GATC 2 cut(s) 46, 175
BsuRI GGCC 1 cut(s) 41
Cac8I GCNNGC 3 cut(s) 7, 11, 237
CaiI CAGNNNCTG 1 cut(s) 292
CciI TCATGA 1 cut(s) 87
CfoI GCGC 1 cut(s) 241
Cfr10I RCCGGY 1 cut(s) 20
Csp6I GTAC 2 cut(s) 68, 284
CviAII CATG 1 cut(s) 88
CviJI RGCY 4 cut(s) 13, 41, 277, 292
CviKI_1 RGCY 4 cut(s) 13, 41, 277, 292
CviQI GTAC 2 cut(s) 68, 284
DpnI GATC 2 cut(s) 48, 177
DpnII GATC 2 cut(s) 46, 175
EaeI YGGCCR 1 cut(s) 39
Eco130I CCWWGG 1 cut(s) 138
Eco47III AGCGCT 1 cut(s) 240
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 91
FaiI YATR 6 cut(s) 89, 165, 174, 182, 272, 281
FatI CATG 1 cut(s) 87
FspBI CTAG 1 cut(s) 236
GlaI GCGC 1 cut(s) 240
HaeII RGCGCY 1 cut(s) 242
HaeIII GGCC 1 cut(s) 41
HapII CCGG 1 cut(s) 21
HhaI GCGC 1 cut(s) 241
Hin1II CATG 1 cut(s) 91
Hin6I GCGC 1 cut(s) 239
HinP1I GCGC 1 cut(s) 239
HinfI GANTC 1 cut(s) 247
HpaII CCGG 1 cut(s) 21
HphI GGTGA 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 3 cut(s) 88, 152, 300
HpyCH4V TGCA 2 cut(s) 122, 222
Hsp92II CATG 1 cut(s) 91
HspAI GCGC 1 cut(s) 239
Kzo9I GATC 2 cut(s) 46, 175
LmnI GCTCC 2 cut(s) 115, 302
LpnPI CCDG 2 cut(s) 34, 285
MaeI CTAG 1 cut(s) 236
MalI GATC 2 cut(s) 48, 177
MboI GATC 2 cut(s) 46, 175
MboII GAAGA 4 cut(s) 103, 199, 202, 214
MfeI CAATTG 1 cut(s) 123
MlsI TGGCCA 1 cut(s) 41
MluCI AATT 4 cut(s) 75, 123, 217, 255
MluNI TGGCCA 1 cut(s) 41
MnlI CCTC 5 cut(s) 52, 55, 93, 123, 282
Mox20I TGGCCA 1 cut(s) 41
MscI TGGCCA 1 cut(s) 41
MseI TTAA 1 cut(s) 195
Msp20I TGGCCA 1 cut(s) 41
MspI CCGG 1 cut(s) 21
MunI CAATTG 1 cut(s) 123
NdeII GATC 2 cut(s) 46, 175
NheI GCTAGC 1 cut(s) 235
NlaIII CATG 1 cut(s) 91
PagI TCATGA 1 cut(s) 87
PfeI GAWTC 1 cut(s) 247
PflMI CCANNNNNTGG 1 cut(s) 257
PstNI CAGNNNCTG 1 cut(s) 292
RsaI GTAC 2 cut(s) 69, 285
RsaNI GTAC 2 cut(s) 68, 284
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 2 cut(s) 46, 175
ScaI AGTACT 1 cut(s) 69
SetI ASST 1 cut(s) 15
Sse9I AATT 4 cut(s) 75, 123, 217, 255
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 138
TaqI TCGA 1 cut(s) 98
TasI AATT 4 cut(s) 75, 123, 217, 255
TatI WGTACW 1 cut(s) 67
TfiI GAWTC 1 cut(s) 247
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspDTI ATGAA 2 cut(s) 76, 104
Van91I CCANNNNNTGG 1 cut(s) 257
XspI CTAG 1 cut(s) 236
ZrmI AGTACT 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.