Rh1CG270300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001272
Physical Location & Seq
Forward (+)
53628487 .. 53629467
981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG270300.1

Sequence Viewer

Length: 444 bp
ATGGAACAACAAATTGCGAAATCACCAACTTCAGCCTCATGCCCGAAAGAATCTTGGCCTCTAATCAGTATCAGTGAGCATGTAGCAATGCCTTCCTCACGGGCTTTGTTGCTTCCAACCAGTATATACAAAGAACTTAAAATTTCAGCAATCATGATTGAAGAACATGACCTGTCTTCGTCTAAGCAGGACTTTGTGTTGCCCCCCAGCCCGCAGTCTTGTGTACTTCATTGCATGGTCCCCAAACTTTCAGGAATGCCAATAACAGAGACCAGAGCACCATATATCCCTGACAGTTGTAACCTGGCTCTGTATCCAAAGCTCTTGGTGACTATGAAGCCCTGCAGTATTGAAAGCAAAACAACAAAACCATGGAAAGTAAATGTTGTTATTTGCAAAGCCACAGAATTTGGCTCGAGTAAAGATGGTGCTTTCTTCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.17

Weight (kDa)

8.2

Isoelectric Point (pI)

65.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 212
AcsI RAATTY 2 cut(s) 141, 407
AcuI CTGAAG 1 cut(s) 15
AfaI GTAC 1 cut(s) 225
AgsI TTSAA 2 cut(s) 161, 353
AjnI CCWGG 1 cut(s) 303
AluBI AGCT 1 cut(s) 322
AluI AGCT 1 cut(s) 322
Alw21I GWGCWC 1 cut(s) 280
Alw26I GTCTC 1 cut(s) 263
Ama87I CYCGRG 1 cut(s) 415
AoxI GGCC 1 cut(s) 56
ApoI RAATTY 2 cut(s) 141, 407
AspS9I GGNCC 1 cut(s) 238
AsuHPI GGTGA 2 cut(s) 15, 340
AvaI CYCGRG 1 cut(s) 415
AvaII GGWCC 1 cut(s) 238
BbsI GAAGAC 1 cut(s) 168
Bbv12I GWGCWC 1 cut(s) 280
BccI CCATC 1 cut(s) 419
BciT130I CCWGG 1 cut(s) 305
BciVI GTATCC 1 cut(s) 324
BcoDI GTCTC 1 cut(s) 263
BfmI CTRYAG 1 cut(s) 343
BfuI GTATCC 1 cut(s) 324
Bme1390I CCNGG 1 cut(s) 305
Bme18I GGWCC 1 cut(s) 238
BmeT110I CYCGRG 1 cut(s) 415
BmgT120I GGNCC 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 305
BpiI GAAGAC 1 cut(s) 168
BsaI GGTCTC 1 cut(s) 263
BsaJI CCNNGG 1 cut(s) 371
Bse1I ACTGG 1 cut(s) 120
Bse3DI GCAATG 2 cut(s) 93, 229
BseBI CCWGG 1 cut(s) 305
BseDI CCNNGG 1 cut(s) 371
BseMI GCAATG 2 cut(s) 93, 229
BseNI ACTGG 1 cut(s) 120
BseYI CCCAGC 1 cut(s) 206
BshFI GGCC 1 cut(s) 58
BsiHKAI GWGCWC 1 cut(s) 280
BsiHKCI CYCGRG 1 cut(s) 415
BslFI GGGAC 1 cut(s) 224
BsmAI GTCTC 1 cut(s) 263
BsmFI GGGAC 1 cut(s) 224
BsmI GAATGC 1 cut(s) 261
BsnI GGCC 1 cut(s) 58
Bso31I GGTCTC 1 cut(s) 263
BsoBI CYCGRG 1 cut(s) 415
Bsp1286I GDGCHC 1 cut(s) 280
Bsp19I CCATGG 1 cut(s) 371
BspACI CCGC 1 cut(s) 212
BspANI GGCC 1 cut(s) 58
BspHI TCATGA 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 240
BspMAI CTGCAG 1 cut(s) 347
BspTNI GGTCTC 1 cut(s) 263
BsrDI GCAATG 2 cut(s) 93, 229
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 371
BssT1I CCWWGG 1 cut(s) 371
Bst2UI CCWGG 1 cut(s) 305
Bst4CI ACNGT 1 cut(s) 296
BstC8I GCNNGC 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 183
BstDSI CCRYGG 1 cut(s) 371
BstMAI GTCTC 1 cut(s) 263
BstNI CCWGG 1 cut(s) 305
BstNSI RCATGY 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 303
BstSFI CTRYAG 1 cut(s) 343
BstV2I GAAGAC 1 cut(s) 168
BsuI GTATCC 1 cut(s) 324
BsuRI GGCC 1 cut(s) 58
BtgI CCRYGG 1 cut(s) 371
BtsIMutI CAGTG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 212
CciI TCATGA 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 238
Csp6I GTAC 1 cut(s) 224
CspCI CAANNNNNGTGG 2 cut(s) 391, 426
CviAII CATG 7 cut(s) 39, 80, 154, 167, 235, 372, 439
CviJI RGCY 9 cut(s) 35, 58, 104, 210, 308, 322, 340, 401, 414
CviKI_1 RGCY 9 cut(s) 35, 58, 104, 210, 308, 322, 340, 401, 414
CviQI GTAC 1 cut(s) 224
DdeI CTNAG 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 371
Eco31I GGTCTC 1 cut(s) 263
Eco47I GGWCC 1 cut(s) 238
Eco57I CTGAAG 1 cut(s) 15
Eco88I CYCGRG 1 cut(s) 415
EcoRII CCWGG 1 cut(s) 303
EcoT14I CCWWGG 1 cut(s) 371
ErhI CCWWGG 1 cut(s) 371
FaeI CATG 7 cut(s) 42, 83, 157, 170, 238, 375, 442
FalI AAGNNNNNCTT 2 cut(s) 176, 208
FaqI GGGAC 1 cut(s) 224
FatI CATG 7 cut(s) 38, 79, 153, 166, 234, 371, 438
FauI CCCGC 1 cut(s) 219
GsaI CCCAGC 1 cut(s) 210
HaeIII GGCC 1 cut(s) 58
Hin1II CATG 7 cut(s) 42, 83, 157, 170, 238, 375, 442
HinfI GANTC 1 cut(s) 50
HphI GGTGA 2 cut(s) 15, 340
Hpy166II GTNNAC 1 cut(s) 224
Hpy188III TCNNGA 2 cut(s) 154, 252
Hpy8I GTNNAC 1 cut(s) 224
HpyAV CCTTC 1 cut(s) 102
HpyCH4III ACNGT 1 cut(s) 296
HpyCH4V TGCA 3 cut(s) 234, 345, 396
HpyF3I CTNAG 1 cut(s) 183
Hsp92II CATG 7 cut(s) 42, 83, 157, 170, 238, 375, 442
MaeIII GTNAC 2 cut(s) 299, 328
MboII GAAGA 3 cut(s) 168, 173, 427
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 3 cut(s) 12, 141, 407
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 3 cut(s) 46, 69, 106
MseI TTAA 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 305
Mva1269I GAATGC 1 cut(s) 261
MvaI CCWGG 1 cut(s) 305
NcoI CCATGG 1 cut(s) 371
NlaIII CATG 7 cut(s) 42, 83, 157, 170, 238, 375, 442
NlaIV GGNNCC 1 cut(s) 240
NmuCI GTSAC 1 cut(s) 328
NspI RCATGY 1 cut(s) 83
PaeR7I CTCGAG 1 cut(s) 415
PagI TCATGA 1 cut(s) 153
PctI GAATGC 1 cut(s) 261
PfeI GAWTC 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 303
PspFI CCCAGC 1 cut(s) 206
PspGI CCWGG 1 cut(s) 303
PspN4I GGNNCC 1 cut(s) 240
PspPI GGNCC 1 cut(s) 238
PspXI VCTCGAGB 1 cut(s) 415
PstI CTGCAG 1 cut(s) 347
RsaI GTAC 1 cut(s) 225
RsaNI GTAC 1 cut(s) 224
SaqAI TTAA 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 305
SduI GDGCHC 1 cut(s) 280
SetI ASST 3 cut(s) 174, 306, 324
SfcI CTRYAG 1 cut(s) 343
Sfr274I CTCGAG 1 cut(s) 415
SinI GGWCC 1 cut(s) 238
SlaI CTCGAG 1 cut(s) 415
SmlI CTYRAG 1 cut(s) 415
SmoI CTYRAG 1 cut(s) 415
Sse9I AATT 3 cut(s) 12, 141, 407
SsiI CCGC 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 303
StyI CCWWGG 1 cut(s) 371
TaaI ACNGT 1 cut(s) 296
TaqI TCGA 1 cut(s) 416
TasI AATT 3 cut(s) 12, 141, 407
TatI WGTACW 1 cut(s) 223
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 79
TseFI GTSAC 1 cut(s) 328
Tsp45I GTSAC 1 cut(s) 328
TspDTI ATGAA 3 cut(s) 218, 350, 427
TspRI CASTG 1 cut(s) 79
VpaK11BI GGWCC 1 cut(s) 238
XapI RAATTY 2 cut(s) 141, 407
XceI RCATGY 1 cut(s) 83
XhoI CTCGAG 1 cut(s) 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.