Rh1DG302900

DUF1785

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
52965201 .. 52965815
615 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG302900.1

Sequence Viewer

Length: 276 bp
ATGGTTAATGGTGGCACAGTGGATTTCTGGGCGTTTGTAAATTTCTCTGGAATACCCGAAGAATCTAGCGATTGCTTTATTAAGGCACTCGTCCCCATGTGCAATAGTAAAGGGATGGTCTCATTAAAAGAATCTATGAAACAAAGCTCGGAATTGTCTCCCAGTGCTGTATTTCTAACCATGTATCAAAGTGCATGTAGTAAGCAATACCTTGAAAATCTGTCTCTTAAGATTAATGTCAAGGTTGGTGCATGGCAGTGGAGGATTACTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.12

Weight (kDa)

7.62

Isoelectric Point (pI)

39.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 40
AflII CTTAAG 1 cut(s) 227
AgsI TTSAA 1 cut(s) 215
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Alw26I GTCTC 3 cut(s) 124, 162, 228
ApoI RAATTY 1 cut(s) 40
AseI ATTAAT 1 cut(s) 234
BccI CCATC 1 cut(s) 109
BcoDI GTCTC 3 cut(s) 124, 162, 228
BfaI CTAG 1 cut(s) 66
BfrI CTTAAG 1 cut(s) 227
BmrI ACTGGG 1 cut(s) 156
BmuI ACTGGG 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 120
BseNI ACTGG 1 cut(s) 162
BslFI GGGAC 1 cut(s) 77
BsmAI GTCTC 3 cut(s) 124, 162, 228
BsmFI GGGAC 1 cut(s) 77
Bso31I GGTCTC 1 cut(s) 124
BspTI CTTAAG 1 cut(s) 227
BspTNI GGTCTC 1 cut(s) 124
BsrI ACTGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 19
BstAFI CTTAAG 1 cut(s) 227
BstF5I GGATG 1 cut(s) 120
BstMAI GTCTC 3 cut(s) 124, 162, 228
BstNSI RCATGY 1 cut(s) 198
BtsCI GGATG 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 263
BtsIMutI CAGTG 3 cut(s) 24, 169, 263
CviAII CATG 4 cut(s) 97, 181, 195, 252
CviJI RGCY 1 cut(s) 147
CviKI_1 RGCY 1 cut(s) 147
Eco31I GGTCTC 1 cut(s) 124
FaeI CATG 4 cut(s) 100, 184, 198, 255
FaiI YATR 5 cut(s) 98, 137, 182, 196, 253
FaqI GGGAC 1 cut(s) 77
FatI CATG 4 cut(s) 96, 180, 194, 251
FokI GGATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 66
Hin1II CATG 4 cut(s) 100, 184, 198, 255
HinfI GANTC 2 cut(s) 62, 131
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 3 cut(s) 102, 194, 251
Hsp92II CATG 4 cut(s) 100, 184, 198, 255
LpnPI CCDG 3 cut(s) 13, 33, 175
MaeI CTAG 1 cut(s) 66
MboII GAAGA 1 cut(s) 71
MluCI AATT 2 cut(s) 40, 152
MnlI CCTC 1 cut(s) 255
MseI TTAA 5 cut(s) 6, 81, 125, 228, 234
MslI CAYNNNNRTG 1 cut(s) 256
MspCI CTTAAG 1 cut(s) 227
NlaIII CATG 4 cut(s) 100, 184, 198, 255
NspI RCATGY 1 cut(s) 198
PfeI GAWTC 2 cut(s) 62, 131
PshBI ATTAAT 1 cut(s) 234
RseI CAYNNNNRTG 1 cut(s) 256
SaqAI TTAA 5 cut(s) 6, 81, 125, 228, 234
SetI ASST 3 cut(s) 149, 213, 246
SmiMI CAYNNNNRTG 1 cut(s) 256
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 40, 152
SspMI CTAG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 19
TasI AATT 2 cut(s) 40, 152
TfiI GAWTC 2 cut(s) 62, 131
Tru1I TTAA 5 cut(s) 6, 81, 125, 228, 234
Tru9I TTAA 5 cut(s) 6, 81, 125, 228, 234
TscAI CASTG 3 cut(s) 24, 169, 263
TspDTI ATGAA 1 cut(s) 152
TspRI CASTG 3 cut(s) 24, 169, 263
Vha464I CTTAAG 1 cut(s) 227
VspI ATTAAT 1 cut(s) 234
XapI RAATTY 1 cut(s) 40
XceI RCATGY 1 cut(s) 198
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.