Rh2DG055700

Aldehyde dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
4065243 .. 4065745
503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG055700.1

Sequence Viewer

Length: 303 bp
ATGGACATTGACAAAGTCAGGTTTACTGGTTCCACAGACGTAGGCCGTAAAGTGATGCAGGCTGCAGCAAAGAGCAACTTAAAAGCAGTTTCACTTGAACTAGGGGGCAAGTCACCCCTTTTAATTTTTGATGATGCTGATGTAGATAAGGCTGCTGACCTTGCTCTCTTGAGAATCCTCTACAACAAGGGAGAAACTTGTGTGGCAAGTTCTGTTGTTTTTGTTCAAGAAGGGATCTATGATGGAACTTGTGAAGAAATTAGAAGTAAAGGCAAAATCTTGGGCTGTTGGGGATCCTTTTGA

Protein Analysis

100

Amino Acids

10.75

Weight (kDa)

5.34

Isoelectric Point (pI)

24.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldedh PF00171 2 - 89 8.4e-29 Aldehyde dehydrogenase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 242, 288, 301
AgsI TTSAA 2 cut(s) 98, 227
AlwI GGATC 3 cut(s) 242, 288, 301
AoxI GGCC 1 cut(s) 43
ApeKI GCWGC 3 cut(s) 62, 65, 152
AsuHPI GGTGA 1 cut(s) 105
BamHI GGATCC 1 cut(s) 293
BbvI GCAGC 3 cut(s) 49, 77, 139
BccI CCATC 1 cut(s) 236
BceAI ACGGC 1 cut(s) 30
BfaI CTAG 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 63
BisI GCNGC 3 cut(s) 63, 66, 153
BlsI GCNGC 3 cut(s) 64, 67, 154
BmiI GGNNCC 2 cut(s) 31, 295
BmsI GCATC 2 cut(s) 45, 124
BpuEI CTTGAG 1 cut(s) 190
Bse1I ACTGG 1 cut(s) 31
BseNI ACTGG 1 cut(s) 31
BseXI GCAGC 3 cut(s) 49, 77, 139
BshFI GGCC 1 cut(s) 45
BsnI GGCC 1 cut(s) 45
Bsp143I GATC 2 cut(s) 234, 293
BspANI GGCC 1 cut(s) 45
BspLI GGNNCC 2 cut(s) 31, 295
BspMAI CTGCAG 1 cut(s) 67
BspPI GGATC 3 cut(s) 242, 288, 301
BsrI ACTGG 1 cut(s) 31
BssMI GATC 2 cut(s) 234, 293
BstC8I GCNNGC 1 cut(s) 60
BstKTI GATC 2 cut(s) 237, 296
BstMBI GATC 2 cut(s) 234, 293
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 63
BstV1I GCAGC 3 cut(s) 49, 77, 139
BstX2I RGATCY 2 cut(s) 234, 293
BstYI RGATCY 2 cut(s) 234, 293
BsuRI GGCC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 60
CviJI RGCY 4 cut(s) 45, 62, 152, 285
CviKI_1 RGCY 4 cut(s) 45, 62, 152, 285
DpnI GATC 2 cut(s) 236, 295
DpnII GATC 2 cut(s) 234, 293
FaiI YATR 1 cut(s) 240
FalI AAGNNNNNCTT 2 cut(s) 62, 94
Fnu4HI GCNGC 3 cut(s) 63, 66, 153
Fsp4HI GCNGC 3 cut(s) 63, 66, 153
FspBI CTAG 1 cut(s) 101
GluI GCNGC 3 cut(s) 63, 66, 153
HaeIII GGCC 1 cut(s) 45
HinfI GANTC 1 cut(s) 174
HphI GGTGA 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 24
Hpy188III TCNNGA 2 cut(s) 169, 227
Hpy8I GTNNAC 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 224
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 58, 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
HpySE526I ACGT 1 cut(s) 39
Kzo9I GATC 2 cut(s) 234, 293
LpnPI CCDG 3 cut(s) 4, 12, 44
Lsp1109I GCAGC 3 cut(s) 49, 77, 139
LweI GCATC 2 cut(s) 45, 124
MaeI CTAG 1 cut(s) 101
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 111
MalI GATC 2 cut(s) 236, 295
MboI GATC 2 cut(s) 234, 293
MboII GAAGA 1 cut(s) 266
MflI RGATCY 2 cut(s) 234, 293
MluCI AATT 2 cut(s) 123, 258
MnlI CCTC 1 cut(s) 188
MseI TTAA 2 cut(s) 80, 122
MwoI GCNNNNNNNGC 1 cut(s) 161
NdeII GATC 2 cut(s) 234, 293
NlaIV GGNNCC 2 cut(s) 31, 295
NmuCI GTSAC 1 cut(s) 111
PfeI GAWTC 1 cut(s) 174
PflFI GACNNNGTC 1 cut(s) 14
PkrI GCNGC 3 cut(s) 64, 67, 154
PspN4I GGNNCC 2 cut(s) 31, 295
PstI CTGCAG 1 cut(s) 67
PsuI RGATCY 2 cut(s) 234, 293
PsyI GACNNNGTC 1 cut(s) 14
SaqAI TTAA 2 cut(s) 80, 122
SatI GCNGC 3 cut(s) 63, 66, 153
Sau3AI GATC 2 cut(s) 234, 293
SetI ASST 3 cut(s) 23, 42, 162
SfaNI GCATC 2 cut(s) 45, 124
SfcI CTRYAG 1 cut(s) 63
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
Sse9I AATT 2 cut(s) 123, 258
SspMI CTAG 1 cut(s) 101
TaiI ACGT 1 cut(s) 42
TasI AATT 2 cut(s) 123, 258
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 2 cut(s) 80, 122
Tru9I TTAA 2 cut(s) 80, 122
TseFI GTSAC 1 cut(s) 111
TseI GCWGC 3 cut(s) 62, 65, 152
Tsp45I GTSAC 1 cut(s) 111
Tth111I GACNNNGTC 1 cut(s) 14
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.